ID: 1018940959

View in Genome Browser
Species Human (GRCh38)
Location 6:168308633-168308655
Sequence CAGGGTGGCTGGAGTACAGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 614
Summary {0: 1, 1: 2, 2: 8, 3: 69, 4: 534}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018940959_1018940964 -7 Left 1018940959 6:168308633-168308655 CCGTCTGTACTCCAGCCACCCTG 0: 1
1: 2
2: 8
3: 69
4: 534
Right 1018940964 6:168308649-168308671 CACCCTGCCTCTGTGGAGATGGG 0: 1
1: 0
2: 1
3: 24
4: 218
1018940959_1018940963 -8 Left 1018940959 6:168308633-168308655 CCGTCTGTACTCCAGCCACCCTG 0: 1
1: 2
2: 8
3: 69
4: 534
Right 1018940963 6:168308648-168308670 CCACCCTGCCTCTGTGGAGATGG 0: 1
1: 0
2: 3
3: 30
4: 295
1018940959_1018940969 13 Left 1018940959 6:168308633-168308655 CCGTCTGTACTCCAGCCACCCTG 0: 1
1: 2
2: 8
3: 69
4: 534
Right 1018940969 6:168308669-168308691 GGGGACGCTGCATGCCTTAGAGG 0: 1
1: 0
2: 1
3: 9
4: 64
1018940959_1018940965 -6 Left 1018940959 6:168308633-168308655 CCGTCTGTACTCCAGCCACCCTG 0: 1
1: 2
2: 8
3: 69
4: 534
Right 1018940965 6:168308650-168308672 ACCCTGCCTCTGTGGAGATGGGG 0: 1
1: 0
2: 2
3: 17
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018940959 Original CRISPR CAGGGTGGCTGGAGTACAGA CGG (reversed) Exonic
900403334 1:2481812-2481834 CAGAGAGGATGCAGTACAGATGG - Intronic
900482372 1:2905418-2905440 CTGGGGGGCTGGAGCACAGAGGG - Intergenic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
901864357 1:12094419-12094441 CAGTGTGGCTAGAGATCAGAGGG + Intronic
902515753 1:16988571-16988593 CATGGTGCCTGGTGTACAGGAGG + Intronic
902878461 1:19355040-19355062 CAGAGGGGCTGGAGGCCAGAAGG - Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903141578 1:21342374-21342396 CAGGGTGGTTTGAGTACAACCGG + Intronic
903293504 1:22329303-22329325 CTGAGTGGCTGGAGTAGAGTGGG - Intergenic
903320560 1:22540658-22540680 CAGGGTGGCTGGAGCAGAGTGGG + Intergenic
903568387 1:24285869-24285891 CACGGTGCCTGGAGCACAGTGGG - Intergenic
903864064 1:26385223-26385245 GAGGGTGGCTGGAGCCCGGAAGG + Intergenic
904076443 1:27846307-27846329 CAGTGTTTCTGGAGCACAGAGGG - Intronic
904263845 1:29306620-29306642 CTGGGTGGCTGGAGAGGAGAGGG + Intronic
904910249 1:33929226-33929248 GAGGGTGGCCGGAGTAGAGGTGG - Intronic
905019937 1:34802518-34802540 GAGGATGGCTTGAGTACAGGAGG - Intronic
905315611 1:37080611-37080633 CAGGGTGGCTGCCGGACGGAGGG - Intergenic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
906827212 1:48994140-48994162 CACTGTGGCTGGAATACAGGTGG - Intronic
907400271 1:54221005-54221027 CAGGGCAGCTGGAATACAGGAGG - Intronic
907470767 1:54672055-54672077 CAGTGTGACTGGAGCCCAGAGGG + Intronic
907650014 1:56286133-56286155 CTGGGTGGTTGGTGTACACAGGG - Intergenic
907867416 1:58411683-58411705 CAGCATAGCTGGAGTAGAGAGGG + Intronic
907869196 1:58427514-58427536 CAGGGTGGCAGCAGTGCAGCTGG + Intronic
908370200 1:63473267-63473289 CGGGGTGGCTGCCGGACAGAGGG - Intronic
909180164 1:72413761-72413783 CATGGTGGCTGGACTATAGTGGG + Intergenic
909502644 1:76353175-76353197 CAGGGTGGCTGGAGAGGAGATGG - Intronic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912358405 1:109074043-109074065 CAGGGTGGCGGCAGGGCAGAGGG - Intronic
912679892 1:111722328-111722350 CAGGGTGGCCGGAGGGCAGGAGG + Exonic
913106018 1:115614821-115614843 GAGGATGGCTTGAGTCCAGAAGG - Intergenic
914460512 1:147878966-147878988 CAAGATGCCTGGAGGACAGAGGG + Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
916139795 1:161685592-161685614 GAGGGTTGCTTGAGTACAGGAGG + Intergenic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
917468610 1:175306896-175306918 CAGAGTGGCTGAAGCACAGATGG - Intergenic
918169581 1:181983715-181983737 CAGGGTGGCAGGAATCCTGATGG - Intergenic
919958232 1:202439589-202439611 CAGGGTCCATGGTGTACAGAGGG - Intronic
920275875 1:204803789-204803811 CAGGGTGCTAGGAGAACAGAGGG - Intergenic
920541254 1:206779786-206779808 CAATGAGGCTGGAGTGCAGAGGG - Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
921836890 1:219787518-219787540 CAGGCTGGGTGCAGTACTGAAGG - Intronic
922205192 1:223440270-223440292 CAGGGAGGGTGGAGTAGAGATGG + Intergenic
922733029 1:227961997-227962019 CAAGCTGGCTGGAGTTCACAGGG + Intergenic
924073847 1:240312188-240312210 GTGGGTGGCTGGAGAGCAGAGGG - Intronic
924463634 1:244281516-244281538 CAGGATGGGTGGAGTGCAGTGGG - Intergenic
924597855 1:245463052-245463074 AAGTGTGGGTGGAGGACAGAGGG - Intronic
924619508 1:245648543-245648565 AAGGGTGGCTTGAGTCCAGGAGG + Intronic
924924112 1:248661707-248661729 CAGGATGGCTGGAGCAGTGAGGG + Intergenic
1062842027 10:679425-679447 CTGGGTGTGGGGAGTACAGATGG - Intronic
1063207970 10:3853132-3853154 CTGGGTGGCGGGAGCTCAGAGGG + Intergenic
1064141549 10:12794994-12795016 CACGGTGCCTGGAATAGAGAAGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1065520867 10:26570562-26570584 GAGGGTGGCTTGAGTCCAGAAGG - Intergenic
1066029130 10:31399536-31399558 CAGGGTTGTAGGAGTAGAGATGG - Intronic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067775968 10:49165174-49165196 AATGGTGGCTGGAGTCGAGAGGG + Intronic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1069689363 10:70339757-70339779 CAAGGTGGCAGGAGTCCAGCAGG - Intronic
1069924807 10:71841607-71841629 CACGGTGCTTGGATTACAGATGG - Intronic
1069981029 10:72252754-72252776 CCTGTTGGCTGGAGTTCAGAAGG - Intergenic
1070181542 10:74018782-74018804 CTGGGTGGCTGGAGTTCAAGGGG - Intronic
1070868895 10:79730661-79730683 TAGGGTGGCAGCAGTAAAGAAGG + Intergenic
1071003260 10:80855133-80855155 CAGGGTCACAGGAGTAGAGATGG - Intergenic
1071258132 10:83892958-83892980 CAAGGTAGCTGCAGTCCAGAGGG + Intergenic
1071436015 10:85648784-85648806 CAGGGAGGCTGGGGTGCGGATGG - Intronic
1071548558 10:86547759-86547781 CAGGATGGCTTGAGCCCAGAAGG + Intergenic
1071635809 10:87252843-87252865 TAGGGTGGCAGCAGTAAAGAAGG + Intergenic
1071659434 10:87485096-87485118 TAGGGTGGCAGCAGTAAAGAAGG - Intergenic
1073435735 10:103514614-103514636 CAGGGCTGGTGGAGAACAGAGGG + Intronic
1074292523 10:112149276-112149298 GAGGCTGGCTGGAGAACGGATGG + Intergenic
1074971876 10:118545574-118545596 CATGGTGGCTGCAGTCCACAAGG - Intergenic
1075071907 10:119325398-119325420 CTGGGTTGCTGGTGTGCAGAAGG + Intronic
1075790882 10:125083697-125083719 CAGGACGGCTGGAGTCCAGGAGG - Intronic
1075945263 10:126427552-126427574 CAGCGTGGCTGGAATAAAGCAGG + Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076447068 10:130523567-130523589 CAGCGTGGCTGGAATAAAGCCGG + Intergenic
1076812123 10:132892347-132892369 CAGGGTGGCGGGACGACCGAAGG - Exonic
1077197301 11:1287857-1287879 CAGGGAGGCTGCAGCAGAGAGGG - Intronic
1077497881 11:2895319-2895341 CAGGGTGCCTGGAGCAGGGAAGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077900833 11:6487104-6487126 CAGTGTGGCCAGAGCACAGAGGG - Intronic
1078437940 11:11340866-11340888 CAGGGTGGCTGAAGTCTGGATGG - Exonic
1078823985 11:14908552-14908574 CATGGGGGCTGGAATACAGTAGG + Intronic
1079099821 11:17534167-17534189 CCGGGAGGCTGGAGGAGAGAGGG - Intronic
1081444412 11:43116691-43116713 CAGGGAGGCTGAAGTAGGGATGG + Intergenic
1082014462 11:47474241-47474263 CAGGGTGGCTGGAGAATGGCTGG - Intronic
1083001379 11:59294618-59294640 CAGGCTGGCTGGAGTGTAGTGGG + Intergenic
1083211330 11:61188971-61188993 AAGGGTGGCTTGAGTCCAGGAGG - Intergenic
1083255130 11:61490947-61490969 CAGGGTGGCTGGAAAAAGGAGGG + Intergenic
1083948733 11:65941831-65941853 CAGACTGGCTGGCGTACCGAAGG + Intergenic
1084442210 11:69181070-69181092 CACCCAGGCTGGAGTACAGAGGG + Intergenic
1084706638 11:70819745-70819767 CAGCATGGCAGGAGCACAGAGGG - Intronic
1084770056 11:71336814-71336836 CAGGGAGGCTGGAAAGCAGAAGG - Intergenic
1084849405 11:71926858-71926880 CACCCAGGCTGGAGTACAGAGGG - Intronic
1085084111 11:73655481-73655503 CAGGTGGGCTAGAGGACAGAAGG + Intronic
1085278362 11:75314269-75314291 CTGGGAGGCTGGAGTCAAGAGGG + Intronic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1086611100 11:88757237-88757259 GAGGGTGGCTGCAGTCCCGAGGG - Intronic
1087188031 11:95222974-95222996 CACTGTGGTAGGAGTACAGATGG - Intronic
1087237060 11:95731785-95731807 GAGGGTGGCAGCAGTAGAGATGG - Intergenic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1088250751 11:107858999-107859021 CAGGGTGGCAGGAGGAGAAAGGG + Exonic
1088318435 11:108530759-108530781 GAGGGTGCCTGGAGCACAGCTGG + Intronic
1088598701 11:111457586-111457608 CAGGGGCACTGGAGTAGAGATGG - Intronic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089650121 11:119907488-119907510 CTGGGTGGCTGGTGGACAGGTGG + Intergenic
1089652919 11:119926379-119926401 CAGGGTGGATGGAGTAGGGCTGG - Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1089961890 11:122623904-122623926 CAGGGTGGCAGGCAGACAGATGG - Intergenic
1090383052 11:126340045-126340067 CAGGGCTTCTGGAATACAGACGG - Intronic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1091752805 12:3033166-3033188 CAGGGAGGCTGGACTGGAGACGG - Intronic
1092833263 12:12465059-12465081 GAGGATGGCTTGAGTCCAGAAGG - Intronic
1093403823 12:18780338-18780360 CAGGTTTGTTGGAGAACAGATGG - Intergenic
1093986028 12:25534519-25534541 CAAGGTGGCTGGAGGTCACAAGG + Intronic
1094389180 12:29930616-29930638 CAGGGAGGCTGCAGCACACAGGG - Intergenic
1094780296 12:33784366-33784388 CAGGGTAGCTGGACTACAGGCGG + Intergenic
1095577439 12:43757015-43757037 CAGAGTAGCTGGAGTATAGTGGG - Intronic
1095834771 12:46625560-46625582 GAGGATGGCTTGAGCACAGAAGG + Intergenic
1096409647 12:51367920-51367942 CAGGGTGGCAGAAGCACAAAGGG + Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097156637 12:57016613-57016635 CAGGGTGGCTGGAGGGGAGGCGG + Intronic
1097637214 12:62137653-62137675 CAGGGTGGTTGGAGTGGAGGTGG - Intronic
1098236718 12:68424689-68424711 CAGGGTGGCAGCAGTAGAGGAGG + Intergenic
1098867477 12:75779578-75779600 CACAGTGCCTGGAGTATAGAAGG - Intergenic
1099203983 12:79707498-79707520 CACAGTGTCTGGAGTACAGCAGG + Intergenic
1099220840 12:79912023-79912045 CAGTGTGACTGGAGCACAGGGGG - Intronic
1099545179 12:83970373-83970395 CAAGGTGGCTGGGGCACAGCTGG + Intergenic
1100107934 12:91199972-91199994 CAGGCAGGCTGGAGTACAAGTGG - Intergenic
1100270188 12:93017131-93017153 GAGGCTGGCTGGAGAACAAAGGG + Intergenic
1100543374 12:95578892-95578914 CACAGTGTCTGGAGTACAAAAGG + Intergenic
1100663045 12:96720977-96720999 CATCCAGGCTGGAGTACAGAGGG - Intronic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101560144 12:105849295-105849317 CAGAGTTGGTGGAATACAGATGG - Intergenic
1102311097 12:111844887-111844909 CAAGGTGGCTGGAATGCAGTGGG + Intronic
1102459084 12:113089203-113089225 CAGGGTGGCTGGAGTGGAGTGGG + Intronic
1102516085 12:113447819-113447841 CAGGGTGGCTGCAGGGAAGAGGG + Intergenic
1102522954 12:113490569-113490591 AATGGTTGATGGAGTACAGAGGG + Intergenic
1102656288 12:114484937-114484959 CGGGGCGGCTGCAGGACAGAGGG + Intergenic
1103341616 12:120224100-120224122 CAAGGAGGCTGGGGGACAGAGGG - Intronic
1103901143 12:124304108-124304130 CAGGCTGGCTGGAGTCCACAGGG + Intronic
1104261052 12:127182385-127182407 CAGTGTGGCTAGAATACAGCAGG - Intergenic
1104663314 12:130628054-130628076 CTGGGTGTCTGGAGCACAGATGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1104732706 12:131116833-131116855 CAGGGTGGCTGCACTAGAGCAGG + Intronic
1105277987 13:18947360-18947382 CAGAGTGGCTGGGGTGCAGGAGG - Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1106644353 13:31616599-31616621 CAGGCAGGCTGGAGTAAAGTGGG - Intergenic
1108571355 13:51754978-51755000 GGGGATGGCTGGAGCACAGATGG - Intronic
1110240298 13:73259274-73259296 CAGGGAGGCTGGAGAACAGCTGG - Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110590530 13:77251875-77251897 CAGGGTGTTTGGAGAGCAGAGGG - Intronic
1111695794 13:91622092-91622114 CAGGGTGGCTAGAATAAAGCAGG - Intronic
1112338894 13:98536867-98536889 CTGGGCGGCTGGAGGACAGGCGG - Intronic
1112681477 13:101771111-101771133 CATGGGGGCTGTAGTGCAGAAGG + Intronic
1113478103 13:110599698-110599720 CACCCTGGCTGGAGTCCAGAGGG - Intergenic
1113944594 13:114036853-114036875 AAGGTTGGCTGGAGTCCAGCAGG + Intronic
1114229456 14:20767482-20767504 CAAGGTGGTTGGAGCACAGCTGG - Intergenic
1114244756 14:20902351-20902373 CCAGGTGGCTGGACTGCAGAAGG - Intergenic
1115678673 14:35711705-35711727 CAGGGTGGTTGGAGTTCAGGTGG - Intronic
1116877204 14:50123837-50123859 CAGGGTGGCAGCAGTGGAGATGG + Intronic
1117272647 14:54160756-54160778 CAGGGTGGCTGGAGTTCTCAGGG - Intergenic
1117387646 14:55232076-55232098 GAGGCAGGCTGGAGTACAGTAGG - Intergenic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1117753907 14:58954255-58954277 CAGTGTGGCTGGTGCACAGGTGG - Intergenic
1117838071 14:59828449-59828471 AATGCTGGCTAGAGTACAGAGGG + Intronic
1118658932 14:67985818-67985840 CAGGATGGCTGGAGCTCAGGAGG + Intronic
1119664015 14:76471514-76471536 CAGGGAGGCTGGAGCAGAGTGGG - Intronic
1120173777 14:81272331-81272353 CAGGGTGACAGGGGTAGAGAGGG + Intronic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1120547586 14:85829856-85829878 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1120823618 14:88935452-88935474 CAGAGTGGCTGGAGAGGAGAAGG - Intergenic
1121133504 14:91472502-91472524 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1121576067 14:94989249-94989271 CAGAGTGGCTGGTATACAGTAGG - Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122352346 14:101103455-101103477 CAGAGAGGCTGGAGTGCTGAGGG - Intergenic
1123956113 15:25336235-25336257 AAGGGTGGGAGGGGTACAGATGG + Intronic
1124318274 15:28691857-28691879 CACTGAGGCTGGAGTACAGTGGG - Intergenic
1124565166 15:30805600-30805622 CACTGAGGCTGGAGTACAGTGGG + Intergenic
1125651342 15:41320539-41320561 CAGGGTGCCGGGATTGCAGACGG + Intronic
1125904878 15:43382120-43382142 GAGGGTGGCTTGAGTCCAGGAGG + Intronic
1126702612 15:51381582-51381604 CAGGGGGCCTGCAATACAGATGG - Intronic
1128285641 15:66434851-66434873 CCGGGTGGCTGGAGTGAAGTGGG + Intronic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129470649 15:75751642-75751664 CAGGGTGCCTGGTGGACAGCAGG + Intergenic
1129719581 15:77870803-77870825 CATGGTGGCTGCATTTCAGATGG + Intergenic
1130319397 15:82828117-82828139 CATGGTGCCTGGTATACAGAAGG - Intronic
1131543507 15:93296116-93296138 AAGGATGGCTGGAGCCCAGAAGG + Intergenic
1132516328 16:367822-367844 CAGGGCAGCTGGAGTTCCGACGG + Intronic
1132573492 16:654299-654321 GAGGATGGCTGGAGTCCAGCTGG - Intronic
1132645156 16:995895-995917 TAGGATGGCTGAAGTTCAGAGGG + Intergenic
1133365965 16:5210419-5210441 CAGTCTGGCTGGAGGACAGTGGG - Intergenic
1133366776 16:5216461-5216483 CAGGGTGGCTGGGGAACATGAGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1133966784 16:10537514-10537536 CAGTGGGGCTGGAGTGCAGTGGG - Intronic
1134187590 16:12096903-12096925 TAGGGTGGCTGAGGTCCAGAGGG + Intronic
1134362744 16:13546940-13546962 CAGTGTGGCTGTAGCACAGCAGG - Intergenic
1134887318 16:17805093-17805115 CAGCGTTGCTGTAGCACAGAAGG + Intergenic
1135083850 16:19458899-19458921 GAGGGTGGCTGAGGGACAGAGGG - Intronic
1135542088 16:23337980-23338002 GAGGATCGCTGGAGTCCAGAAGG + Intronic
1136542477 16:30935807-30935829 CGGGGTGGCTGGAGTCCAGGAGG + Intronic
1136851998 16:33619528-33619550 AAGGGTGCCTGGAGGAGAGAGGG + Intergenic
1137265563 16:46866407-46866429 GAGGATGGCTGGAGCTCAGAAGG + Intergenic
1137362351 16:47830313-47830335 CTGGCTGGTTGGAGTACAGCAGG - Intergenic
1137537964 16:49341883-49341905 CTGTGTGGCTGGAGTTCAGTGGG + Intergenic
1138510932 16:57508089-57508111 CTGGAGGGCTGGAGTGCAGAGGG + Intergenic
1139367137 16:66440493-66440515 GAGGCTGGCTGGAGGACACAGGG - Intronic
1139575212 16:67837261-67837283 GAGGATGGCTTGAGTCCAGAAGG - Intronic
1139614429 16:68080336-68080358 GAGGCTGGCTGGAGGACAGTAGG + Intergenic
1140257035 16:73346324-73346346 CATGGTGGCGAGAGGACAGACGG - Intergenic
1141999979 16:87658751-87658773 AGGGGTGGCTGGAGGAGAGAGGG - Intronic
1203113597 16_KI270728v1_random:1467996-1468018 AAGGGTGCCTGGAGGAGAGAGGG + Intergenic
1142478546 17:204365-204387 GTGGGTGGGTGGAGGACAGATGG - Intergenic
1142604638 17:1074688-1074710 CAGGGAGGCTGGAGGCCAGGAGG + Intronic
1142891606 17:2947637-2947659 CAGGCTGGCTGCAGAACAGAAGG - Intronic
1143180696 17:4982304-4982326 CAGGGTGGCTGGGATTCAAAAGG - Intronic
1143575161 17:7788030-7788052 CAGGGTGGCTCCAGGACACAAGG + Intronic
1143679293 17:8464560-8464582 GAAGGTGGGTGGAGTAGAGAGGG - Intronic
1143709147 17:8721900-8721922 CAGGGTAGCTGGAATGAAGAGGG - Intergenic
1143861894 17:9897268-9897290 CGGGGTGGCTGGAGGGTAGAAGG - Exonic
1144539858 17:16130385-16130407 CAGGGTGGCTGGAGCAAAAGAGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144965488 17:19074884-19074906 CAAGGTAGCTGGAGAAGAGAGGG - Intergenic
1144982479 17:19177299-19177321 CAAGGTAGCTGGAGAAGAGAGGG + Intergenic
1144985744 17:19200940-19200962 CAAGGTAGCTGGAGAAGAGAGGG - Intergenic
1145270629 17:21402858-21402880 GTTGGTGGCTGGATTACAGAGGG + Intronic
1145308834 17:21690248-21690270 GTTGGTGGCTGGATTACAGAGGG + Intergenic
1145392023 17:22462416-22462438 GAGGGTTGCTGGAGTGAAGAAGG - Intergenic
1145769006 17:27479114-27479136 CAGGGAGACAGGAGCACAGAGGG - Intronic
1146017684 17:29246996-29247018 TAGGGTGGCTGGAGAAGAGTGGG + Intronic
1146470520 17:33120835-33120857 CCTGGTAGCTGGTGTACAGAAGG + Intronic
1147170848 17:38617878-38617900 CAGGGTGTCTGGTGTCCAGAAGG - Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1147793817 17:43028810-43028832 CAGGGGAGCTGGAGGGCAGAAGG + Exonic
1148497286 17:48060440-48060462 AGGGGTGGCTGGAGCACGGAGGG - Exonic
1148552453 17:48558597-48558619 CTGGGAGGCTGGAGGACGGAGGG + Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148897787 17:50850040-50850062 GAGGGTAGCTGGAGAAGAGAGGG + Intergenic
1149564405 17:57630891-57630913 CGAGGCGGCTGGGGTACAGAAGG + Intronic
1150211603 17:63445132-63445154 CCAGGAGGCTGGAGTGCAGAGGG - Intronic
1150284653 17:63948083-63948105 CAGGGTGGCTGGGGTCCAGCAGG + Intronic
1151042815 17:70883237-70883259 CAGGGTGAGTGGGGTAGAGATGG + Intergenic
1151295120 17:73179626-73179648 CAGGGTGGATGGAGCAGAGCCGG + Intergenic
1151421204 17:73999081-73999103 CCGGGTGGAGAGAGTACAGAGGG + Intergenic
1151487554 17:74410744-74410766 CAGGGTGGCTGGGGTAGAGTGGG + Intergenic
1151703492 17:75755256-75755278 TATGGTGGCTGGATGACAGATGG - Intronic
1151838012 17:76596737-76596759 CAGGGAAGCTGAAGGACAGATGG + Intergenic
1151874161 17:76857067-76857089 CATGGAGGCTGGAGCAGAGATGG + Intergenic
1152277038 17:79363911-79363933 CAGGGTGGCTGGAGTGGAGTGGG - Intronic
1152669476 17:81593821-81593843 CAGGGTAGCTGGAGAGCAGCTGG - Intronic
1153475787 18:5497139-5497161 CAGGGTAGCTGGAATGCAGGGGG + Intronic
1153630780 18:7067813-7067835 AAGGGAGGCAGGAATACAGAAGG - Intronic
1154971744 18:21416651-21416673 CAGCCAGGCTGGAGTACAGTGGG - Intronic
1157125146 18:44949856-44949878 AAGGGTGGGTGGAGTGGAGAGGG - Intronic
1157258158 18:46156678-46156700 CAGTGAGGATGGAGAACAGAGGG + Intergenic
1157579827 18:48767180-48767202 CAGGGTGCCTGGGTTAGAGAAGG + Intronic
1157784698 18:50471057-50471079 CAGGGTAGCTGGAGTGAGGATGG - Intergenic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1158475253 18:57774059-57774081 CAGGGTGGCTGTAGATGAGAGGG - Intronic
1159328058 18:66949549-66949571 CAGGGCGGTTGGAGTACAGCTGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1159923823 18:74249385-74249407 GAGGGTGGTTGGAGTTCACATGG - Intergenic
1160397339 18:78582304-78582326 CATGCTGGCTGGATTACAGCAGG + Intergenic
1160966750 19:1750009-1750031 GAAGGCGGCTGGAGTCCAGAGGG + Intergenic
1160980124 19:1812789-1812811 CAGGGTGGGTCCAGGACAGAAGG + Intergenic
1161080733 19:2308680-2308702 CAGGGTAGGTGGGGTGCAGACGG - Intronic
1161606811 19:5219645-5219667 GAGAGTGGCTGGAGCAGAGAAGG - Intronic
1161615264 19:5266705-5266727 GAGGGTGGCCGGACCACAGAAGG - Intronic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163141232 19:15350211-15350233 CAGGCTGGGTGGATTACAGGTGG + Intergenic
1163429919 19:17261216-17261238 CAGTGTGGCTGGAACACAGGGGG - Intronic
1163613619 19:18313320-18313342 CAGGGTGGCTGGGGGCCAGGTGG + Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165028885 19:32983018-32983040 AAGGGTGCCTGGAGGAGAGAGGG - Intronic
1165421786 19:35725646-35725668 CAGGGTGGGTGGAGGCCTGAAGG + Intronic
1165467489 19:35983656-35983678 CAGGGTGGCTGCAGTGCACTGGG - Intergenic
1165995338 19:39839941-39839963 CAGGGTGGCTGGAGGACACTTGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166219612 19:41355995-41356017 CAGTATGGCTGGAGCCCAGACGG + Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1167079135 19:47267317-47267339 CAGGCTGGATGGAGTGCAGTGGG + Intronic
1168173995 19:54609545-54609567 CCGGGAGGGTGGAGGACAGATGG - Intronic
925663085 2:6223397-6223419 CAGGGTCCCTGCAGTGCAGAGGG - Intergenic
926447810 2:12965556-12965578 CAGGGTAGCTGGAGGGAAGATGG - Intergenic
927128523 2:20036233-20036255 CATGGTGGCTGGCACACAGAGGG - Intronic
927560567 2:24069524-24069546 CTGGGTGGTTGGAACACAGATGG - Intronic
929020691 2:37549683-37549705 CAGGGTGGCTGAAGGAAACATGG - Intergenic
929119696 2:38474291-38474313 CAGGAGGGATGGAATACAGAAGG + Intergenic
929171104 2:38934392-38934414 CAGGGTGGCTTGAATGCAGAGGG - Intronic
929279463 2:40062103-40062125 CAGGGTGGCAGCAGTAGGGAAGG - Intergenic
930233325 2:48864876-48864898 CAGGGTGTGGGGAGGACAGAAGG + Intergenic
932076849 2:68672301-68672323 TAGTGTGGCTGGAGTAAGGAGGG + Intergenic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
932797451 2:74709073-74709095 GAGGTTGGCTTGAGTCCAGATGG + Intergenic
933699454 2:85244148-85244170 CAGAGTGGCTGGAGCAGAGTGGG + Intronic
933870653 2:86562843-86562865 CAGGGAGGACGGAGAACAGACGG + Intronic
934638677 2:96012883-96012905 CACTGTGCCTGGTGTACAGAAGG - Intergenic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
935589772 2:104835766-104835788 CCGGGTGGCTGGACTCCAAATGG - Intergenic
935760581 2:106316888-106316910 CAGGGTGCCTGGAATATAGTAGG + Intergenic
937321016 2:120960794-120960816 CAGGGTGCCGGCAGGACAGAGGG + Intronic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
938798842 2:134741296-134741318 CAGGGTGGCTGGAGTATGGTGGG + Intergenic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
940860919 2:158769975-158769997 CAGGGAGGAGGAAGTACAGAAGG - Intergenic
940876966 2:158907488-158907510 CAGGGTGGTGGGGGTAAAGATGG + Intergenic
940919038 2:159287139-159287161 CAGGGTGGCCGAAATAGAGAAGG - Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941201674 2:162518869-162518891 CAGAGTGGCTGATGCACAGAAGG + Intronic
941771457 2:169350044-169350066 CAGGGTGGCAGAAGTGAAGATGG + Intronic
941786627 2:169505750-169505772 CAGGGTGGCTGCTGGGCAGAGGG - Exonic
943411726 2:187556692-187556714 CAGGGTGGCTGCTGGGCAGAGGG - Intronic
943731776 2:191309619-191309641 CAGCGTGGCTGGGGAAGAGAGGG - Intronic
944973987 2:205026297-205026319 CAGGGTGGCTGCAGTGTAGTGGG + Intronic
945316663 2:208377616-208377638 CAGGGTGGCTGCTGGGCAGAGGG + Intronic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
945712483 2:213316162-213316184 CAGAGTGGCTGGAGTAATCAAGG - Intronic
945811525 2:214555317-214555339 CAAGGTGGTTGGATTACAGCTGG - Intronic
946157837 2:217818500-217818522 CAGTGTGGCTGGCGTCCACACGG - Exonic
946187654 2:217990234-217990256 GAGTGTGGCTGGTGTATAGATGG - Intronic
946382428 2:219358323-219358345 CAGGGTGCCTGGTGGGCAGAGGG - Intergenic
946993247 2:225359913-225359935 CAGGGTGGGAGGTGTGCAGAGGG - Intergenic
947712968 2:232326282-232326304 CAGGGTGGGTGGGGTAGGGAAGG - Intronic
947732651 2:232439738-232439760 CAGGGTGGGTGGGGTAGGGAAGG - Intergenic
948018491 2:234710060-234710082 CGAGGTGGCAGGAGCACAGAAGG - Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
948807118 2:240457806-240457828 CAGGGTGGCTGGAATGCAGCAGG - Intronic
948879744 2:240850654-240850676 CAGGATGGCTGGGCTACAGAAGG + Intergenic
1168975085 20:1958828-1958850 CAAGGTGTCTGGAGTTCACAGGG + Intergenic
1169088835 20:2844836-2844858 CAGTGTGGCTGGAGTGCTGTAGG + Intronic
1169200508 20:3706905-3706927 TAGGGTGGCTCGAAGACAGATGG + Intronic
1169335245 20:4750598-4750620 CAGGTTGGCTGGGGTTCAGCTGG + Intergenic
1169360377 20:4943583-4943605 GAGGATGGCTTGAGTCCAGAAGG + Intronic
1170075635 20:12415730-12415752 AAGGGTGGCTGGAATAAAGCTGG - Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1171157597 20:22890653-22890675 CAGAGTGGCTGAGGTCCAGATGG - Intergenic
1172037680 20:32021229-32021251 CATGGTGGCTGGAGTACAAATGG - Intronic
1172041045 20:32046156-32046178 CATTGTGGCTGGAACACAGAGGG - Intergenic
1172638700 20:36427708-36427730 CAAGGTGGGTGGATCACAGAAGG + Intronic
1172669798 20:36627145-36627167 CAGAGTGGCTGGTGGGCAGAGGG + Intronic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1174883049 20:54302112-54302134 CAGAGGGCCTGGAGTACTGATGG + Intergenic
1175278680 20:57788368-57788390 CAGCGTGGCTGGAGGGCAGCAGG - Intergenic
1175334532 20:58186451-58186473 GAGGGTGGCTGGACAGCAGATGG + Intergenic
1175626012 20:60488863-60488885 CAGGGTGGCTAGAATAAAGCAGG - Intergenic
1175985810 20:62763725-62763747 CAGAGTGGCTGGAGAGGAGAAGG + Intergenic
1176366047 21:6033623-6033645 CGGCGGGGCAGGAGTACAGAGGG + Intergenic
1176385089 21:6135125-6135147 CAGGGACCCTGGAATACAGATGG - Intergenic
1178660607 21:34504391-34504413 CAGGGTGGCCAGAATACAAAAGG + Intergenic
1179738384 21:43403127-43403149 CAGGGACCCTGGAATACAGATGG + Intergenic
1179757470 21:43504922-43504944 CGGCGGGGCAGGAGTACAGAGGG - Intergenic
1180083307 21:45496585-45496607 AAGGGTGGCTGTAGGACAGTGGG - Intronic
1180703060 22:17792110-17792132 CACTGTGGCAGGAGGACAGAAGG + Intronic
1181902615 22:26169033-26169055 CAGGCTGGCTGGATCCCAGAGGG + Intergenic
1182087394 22:27570738-27570760 CAGCGTGGCTGGAGTGGAGTGGG - Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
1182844825 22:33421768-33421790 CAGGGTGCCAGGACTACAGAAGG + Intronic
1183097334 22:35560932-35560954 CAATGTAGCTGGAGCACAGAGGG + Intergenic
1183336244 22:37248534-37248556 AAGGGTGGGTTGAATACAGATGG - Intergenic
1183443104 22:37834606-37834628 CAGGGCGGCTTGAGCCCAGAAGG + Intronic
1183471144 22:38007376-38007398 TAGGGTGGCTGGCAGACAGAAGG + Intronic
1183706801 22:39479296-39479318 CAGGCAGGCTGGAGTACAGTGGG - Intronic
1183875116 22:40773658-40773680 CAGGGTGACTGAAGTATAGAAGG + Intronic
1184355755 22:43978528-43978550 AGGGGTGGCTGGAGGACAGAGGG + Intronic
1184374754 22:44104710-44104732 CAGGGTGGCTGGGGCAGTGAAGG - Intronic
1184781949 22:46654097-46654119 CGGTGTGGCTGGCATACAGAAGG - Intronic
1184841985 22:47057403-47057425 CAGGGTGGCTCGAACCCAGATGG + Intronic
1184978166 22:48077781-48077803 CAGGGGGGCTGGGGAAGAGAGGG + Intergenic
1185015345 22:48339538-48339560 CTGGGTTGCTGGAGTGCAGGCGG - Intergenic
1185185648 22:49398125-49398147 CCGGGTGCCAGGAGTACGGAGGG + Intergenic
1185312355 22:50163093-50163115 CAGGGTGGCAGGAGACCAGGCGG + Intergenic
949534545 3:4985965-4985987 CTGGTTGTCTGGAGTACAGCAGG + Intergenic
949669361 3:6380676-6380698 CAGGCTGGCTGGAGCAGAAATGG + Intergenic
950284924 3:11737110-11737132 TTGGGTGGCTGAAGAACAGATGG - Intergenic
950671724 3:14531411-14531433 CAGGGAGGCTGGGGTCCAGCAGG - Intronic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950991355 3:17441538-17441560 CAAGGTGGCTGGAGGACTGGGGG + Intronic
951356477 3:21672967-21672989 CAAAGGGGCTGCAGTACAGAGGG - Intronic
951577311 3:24126995-24127017 CAAGATGGCTGGAGTTCAGCTGG - Intronic
952971207 3:38651300-38651322 TGGGGTGTCTGGGGTACAGACGG + Intergenic
953154198 3:40354030-40354052 CAGGGTGGGAGGAGTAGAGGTGG - Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
953447622 3:42981018-42981040 CAGAGTGCCTGGAGGAGAGATGG + Intronic
954574229 3:51666412-51666434 CAGGGTGGCTGGTGATAAGAGGG + Exonic
954834930 3:53457884-53457906 CAGGGTGACTGGGGAACAGTGGG + Intergenic
955503825 3:59611381-59611403 CAGTGTGGCTGGAACACAGTGGG + Intergenic
955578168 3:60388857-60388879 CAAGGAGGCTGTGGTACAGAGGG + Intronic
955961579 3:64346317-64346339 CGGTGTGGCTGGAGCACAGTGGG + Intronic
956663276 3:71619592-71619614 CACGTTGGCTTGAGTACAAAGGG - Intergenic
956720766 3:72115486-72115508 CAGGCTGGGTGGATTACACAAGG + Intergenic
956823262 3:72973053-72973075 CACCCAGGCTGGAGTACAGAGGG - Intronic
956863414 3:73346818-73346840 AGAGGTGGCTGGGGTACAGAGGG + Intergenic
957011425 3:75010033-75010055 CAGATGGGCTAGAGTACAGAAGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957162954 3:76634218-76634240 CAGGGATGCAGGAGCACAGAAGG - Intronic
957842957 3:85694676-85694698 GAGTGTGTCTGGAGTATAGATGG - Intronic
958177166 3:90011323-90011345 GAGAGTGGCTGGTGTACAGCTGG - Intergenic
960260690 3:115564857-115564879 CAAGGCAGCTGGAATACAGATGG + Intergenic
960430546 3:117563310-117563332 CAGTCTGGCTGGAGTGCAGTAGG + Intergenic
960632321 3:119744509-119744531 CAGGCTGGAGGGAGGACAGAGGG + Intronic
961569985 3:127790806-127790828 CAGGCTGGCTGGACTTCAGTAGG - Intronic
961671984 3:128539599-128539621 TAGGGTGGCTGTAATAAAGATGG - Intergenic
961786271 3:129348943-129348965 CAGCAAGGCTGGAGCACAGAGGG + Intergenic
961818457 3:129563273-129563295 CATGGGGGCTGGAATACAGAGGG - Intronic
962350048 3:134650070-134650092 CAATGTGAATGGAGTACAGAGGG - Intronic
962436943 3:135375454-135375476 CAGTGTGGCTGAAATCCAGATGG - Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962945497 3:140165523-140165545 CAGGGTGACGGGAGAACAGGAGG + Intronic
963007992 3:140744116-140744138 CAGAGTGGGTGGAATCCAGAGGG + Intergenic
963054165 3:141171045-141171067 CAAGGTGGCTAGAGTTCACAGGG - Intergenic
964380737 3:156096714-156096736 CGGGGTGCCTGGATTACAGGAGG + Intronic
964390242 3:156189266-156189288 CAGGTTAGCTGGACTACACAGGG - Intronic
964501623 3:157354443-157354465 TAGGGTGGTTGGACTACAGGTGG - Intronic
965666491 3:171099495-171099517 CATGGTGTCTGGAATACAGTGGG - Intronic
965745370 3:171919319-171919341 CAGGGAGGCTGGAACACACAGGG + Intronic
966218669 3:177528631-177528653 TAGAGAGCCTGGAGTACAGAAGG - Intergenic
966865841 3:184258877-184258899 CAGGCTGGCTGGTGTGCAGAGGG - Intronic
966891429 3:184410147-184410169 CACTGTGGCTGGAGTGCAGTGGG - Intronic
967101087 3:186216230-186216252 CAAGGTGGATGGATTACATAAGG - Intronic
967200536 3:187068897-187068919 CAGGGAGGCCTGAGGACAGAGGG - Intronic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
968072861 3:195798075-195798097 CATGCAGGCTGGAGTACAGTGGG - Intronic
968138108 3:196233763-196233785 CAGGGGCCCTGGAGAACAGATGG + Intronic
968770304 4:2501413-2501435 CAGGGAGGCTGGAGCCCAGGAGG + Intronic
969340357 4:6536629-6536651 CAGGGTGGGTGCAGTGGAGAAGG + Intronic
969411279 4:7029967-7029989 CAGGGTGGCAGGAGTGCAGCGGG + Intronic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
969988052 4:11231883-11231905 CAGGGTGTCTGAAGTGCAGTGGG - Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970510968 4:16781443-16781465 GAGGGAGTCTGGAGGACAGAAGG + Intronic
971271505 4:25151339-25151361 AAGGGTGGTTGGAGCACAGCAGG + Intronic
971742276 4:30535889-30535911 CAGGGTGGTAGCAGTAAAGATGG - Intergenic
972450812 4:39196557-39196579 CATGGTGGCAGCAGTAGAGATGG - Intronic
972938483 4:44168065-44168087 CAGGGTGGCGGCAGGGCAGAGGG - Intergenic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
973701870 4:53545463-53545485 CAGGCTGGCTGGATTACCTAGGG + Intronic
975399423 4:73917454-73917476 CTGGGTGGCTCCATTACAGATGG - Intergenic
978217726 4:106226072-106226094 AAGGGTGGCTTGAGCACAGGAGG + Intronic
978356597 4:107881735-107881757 CAGGGCGGGTGAAGTAGAGATGG - Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
983055041 4:163092055-163092077 GAGGATGGCTTGAGTCCAGAAGG - Intergenic
984747639 4:183238550-183238572 CACTGTGGCTGGATTACAGAGGG - Intronic
985193536 4:187403444-187403466 CAGGTTTGCTGGAGATCAGATGG + Intergenic
986040189 5:3986675-3986697 CAGGGTGGCTAGAATAAAGCAGG + Intergenic
986064569 5:4223050-4223072 CGGGGTGGCTGCAGTCCAGGTGG - Intergenic
986134232 5:4959322-4959344 AAGGGTGGCTGGAGCAGGGAAGG - Intergenic
986848721 5:11785348-11785370 AATGATGGCTGGAGTAAAGAAGG + Intronic
986981063 5:13448511-13448533 CAGGGTGCCTAGAATAAAGAAGG - Intergenic
987390948 5:17375148-17375170 AAGGGTGGATGGAGAAGAGATGG - Intergenic
988580278 5:32462784-32462806 CAGGGCAGCTGGAGTAAAGCAGG - Intergenic
991448090 5:66721957-66721979 CAGGGTAGCAGCAGTGCAGAAGG - Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992681088 5:79153812-79153834 CAACATGGCTGGAGTAGAGAGGG + Intronic
993042730 5:82834072-82834094 CAGGGTGGAAGGAGCAGAGAGGG + Intergenic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
993640629 5:90401090-90401112 CAGGGTGATTGGGGAACAGATGG + Intronic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
993820863 5:92614778-92614800 CAGGGTTTCTGAAGTACATAAGG + Intergenic
994241657 5:97429461-97429483 CAGGGTGAATGGAGAAGAGAGGG + Intergenic
995278573 5:110307253-110307275 CAGGGGGGCTAGAGTACCAAGGG - Intronic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996265508 5:121534887-121534909 CAGGCTGCATGGAGTCCAGAGGG + Intergenic
996626812 5:125580071-125580093 GAGGGTGGCTTGAGCACAGGAGG - Intergenic
998056322 5:139081342-139081364 GAGGATGGCTTGAGTCCAGAAGG - Intronic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999764141 5:154725458-154725480 AAGGGTTGCTTGAGTTCAGAAGG + Intronic
1000166759 5:158657314-158657336 CAGGGTGGCTGGACCACAGATGG - Intergenic
1000432918 5:161172004-161172026 ATGGATAGCTGGAGTACAGAGGG - Intergenic
1000922978 5:167160372-167160394 CAGTGAGGCTGGAGCACAGCAGG - Intergenic
1001100309 5:168808836-168808858 CAGGGTGTTTGAAGTACAGATGG + Intronic
1001214786 5:169845457-169845479 CAGGGTGCCTGGCGTGCAGTGGG + Intronic
1001915768 5:175558698-175558720 CAGGCTGGATGGAGTGCAGTGGG - Intergenic
1001929899 5:175665425-175665447 CTGGATGCCTGGAGCACAGAGGG + Intronic
1001945378 5:175773612-175773634 CAGGGTGACTGGAATCCAGGAGG - Intergenic
1003899913 6:10644840-10644862 CAGGATGGCTGGAGTAACAAGGG - Intergenic
1004005229 6:11632031-11632053 CAGGGTGGCTGCTGAACAGTAGG + Intergenic
1004031979 6:11879587-11879609 CAGGGTGGCTGTCTCACAGAGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1004999417 6:21225528-21225550 CAGAGTGCCTGGAATACAGAAGG - Intronic
1005909355 6:30294532-30294554 CAGTGTGTCTGGAGTACATGGGG + Intergenic
1007148810 6:39667219-39667241 CAGGGTCGCTGGCTTTCAGATGG - Intronic
1008198338 6:48553937-48553959 CAGCATGGCTGGAATAAAGAAGG - Intergenic
1008572822 6:52831269-52831291 CAGGGTGGCCTGAGAGCAGAGGG + Intergenic
1008579769 6:52896235-52896257 CAGGGTGGCCTGAGAGCAGAGGG + Intronic
1010367903 6:75073600-75073622 CAGGGTGGGTGAAGGACAGTGGG - Intergenic
1010439412 6:75875996-75876018 CAGGGTGACTGAAGGAGAGAAGG - Intronic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1013955605 6:115836616-115836638 CAGGGTGGCGGCCGGACAGAGGG - Intergenic
1014212253 6:118719480-118719502 CAGGGTAGCTGGAGGTCACAAGG + Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1016123571 6:140373749-140373771 CAGGGTGGCTGCTGGGCAGAGGG + Intergenic
1016355362 6:143212367-143212389 CAGGGAGGCTGGGGTAAAGAAGG - Intronic
1016355750 6:143216366-143216388 CAGGGAGGATGGAGGACAAAAGG + Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017112039 6:150941260-150941282 CAGGGTGGCTGGAGCCCCGTGGG + Intronic
1017175276 6:151497019-151497041 GATGGTGGCTGAAGTACTGATGG - Intronic
1017589425 6:155962413-155962435 CATGGTGGCTGGAATCCAAAAGG + Intergenic
1017660624 6:156670272-156670294 CAGGGTGGCTGCCGGTCAGAGGG - Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019506062 7:1392095-1392117 CAGGGCGGGTGGAGTTGAGAAGG - Intergenic
1020123201 7:5517265-5517287 GGGGGTGGCTGGGGAACAGAGGG + Intergenic
1021033230 7:15764434-15764456 CTGGGTGCCTGGAGTTCAGCTGG + Intergenic
1021772462 7:24019258-24019280 TAGGATGGCTTGAGTACAGGAGG + Intergenic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1024542918 7:50493457-50493479 TAAGGTGGCTGGAGTTCGGAAGG - Intronic
1025936652 7:66043380-66043402 CAGGATTGCTTGAGTCCAGAAGG + Intergenic
1026814692 7:73501379-73501401 CAGTGTGGTTGGACTACAGAAGG - Intronic
1026817778 7:73525606-73525628 CAGGGTACCTGGAGTTCACATGG - Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029886446 7:103877721-103877743 TAGGATGGCTGGAGAAGAGATGG - Intronic
1030028293 7:105346384-105346406 CATGGTGACTGGAACACAGAGGG + Intronic
1030602628 7:111609571-111609593 CAGGGTGCCGGGATTGCAGACGG + Intergenic
1032196746 7:129793876-129793898 CAGGGTGCCTGCAGGACACAGGG - Intergenic
1032446334 7:131986938-131986960 TGGTGTGGCTGGAGTACAGCGGG + Intergenic
1032453135 7:132051888-132051910 CAGGGAGGCAAGAGGACAGACGG + Intergenic
1033145287 7:138865891-138865913 CAGGTTGGCTGGAGAAGTGAAGG + Intronic
1033540339 7:142350169-142350191 CAACATGGCTGGAGTAGAGAAGG - Intergenic
1033755029 7:144391271-144391293 CAGGGTTGCTTGAGTTCAGGAGG + Intergenic
1034037093 7:147836349-147836371 CAGTGTGGCTGGAATACTGGGGG - Intronic
1034524961 7:151652878-151652900 CAGAGTGTCAGGATTACAGATGG + Intronic
1035238544 7:157515742-157515764 CAGGGTGGGTGGAACACAGGAGG - Intergenic
1035334834 7:158121184-158121206 CAGGGAGGCTGGGGTGCAGGGGG - Intronic
1035599777 8:890801-890823 CAGGGTGGCTTGGGCACAGAGGG - Intergenic
1035904030 8:3489637-3489659 CAGGGAAGGTGGATTACAGAAGG + Intronic
1035974415 8:4291943-4291965 CAGGGAGCCTGGTGTCCAGAAGG + Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1038015576 8:23511689-23511711 GGGGGTGGGAGGAGTACAGAAGG - Intergenic
1038331895 8:26615611-26615633 CAGGGGGACTGGTATACAGAAGG - Intronic
1038559321 8:28557522-28557544 CAGGGTAGCTGAACAACAGAAGG - Intronic
1038847890 8:31246678-31246700 GAGGATCGCTTGAGTACAGAAGG - Intergenic
1039620373 8:38991794-38991816 CAGGGTGGTTGGAAGATAGAAGG + Intronic
1040055629 8:43055123-43055145 CAGGGTGGTTGGGGCACAGTGGG + Intronic
1041677297 8:60548883-60548905 CAGGGTGGCTGCCGGGCAGAGGG + Intronic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043167703 8:76925091-76925113 CAGGTTTGCTGAAGTAAAGAGGG + Intergenic
1043886563 8:85607559-85607581 CATCCAGGCTGGAGTACAGATGG + Intergenic
1045031224 8:98138321-98138343 CAGGGTGGCTGAAGTGTAGAAGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045224189 8:100228621-100228643 AAGGATGGCTTGAGTCCAGAAGG + Intronic
1045249628 8:100472686-100472708 CAGGGTGGATGGAGTTGAGTGGG - Intergenic
1045274573 8:100691471-100691493 CAGGCAGGCTGGAGTGCAGTGGG - Intronic
1045799042 8:106080263-106080285 CTGGGTGCCAGGAGTAGAGAAGG - Intergenic
1046683729 8:117201118-117201140 CATGGTGGCTTCTGTACAGATGG + Intergenic
1047213280 8:122856973-122856995 CAGGGTGGCTGGAGCCGAGAAGG - Intronic
1048192339 8:132301335-132301357 CATGGTGGCTGGAGTGGACAGGG - Intronic
1048343674 8:133560052-133560074 CAGGGTGGCTATAGTAAACAAGG + Intronic
1048844687 8:138595219-138595241 CAAGGTGGCAGGAGGACAGGTGG + Intronic
1049639618 8:143708925-143708947 CCGGATGGCTGGAGGACATAGGG + Intronic
1049713312 8:144077348-144077370 CAGAGTGGCTGTAGAGCAGAGGG + Intergenic
1050285299 9:4095702-4095724 CAGTTTAGCTGTAGTACAGATGG - Intronic
1051362226 9:16291372-16291394 CATGGTGACTGTAGTACAGTGGG + Intergenic
1051589791 9:18766062-18766084 AAGTCTGGCTGGAGTACACAGGG + Intronic
1052348795 9:27437049-27437071 TAGGGTGGCTGAAGTCCAGCAGG + Intronic
1052758180 9:32563380-32563402 CAGGATGGCTGGAGTACAGTGGG + Intronic
1053121891 9:35553699-35553721 AAGTGTGGCTGGAGCACAGTGGG + Intronic
1053807842 9:41821592-41821614 CAGGGAGGCAGGAGGTCAGAGGG - Intergenic
1054622750 9:67365836-67365858 CAGGGAGGCAGGAGGTCAGAGGG + Intergenic
1054812549 9:69446558-69446580 AAAGCTTGCTGGAGTACAGACGG - Intronic
1054878863 9:70124126-70124148 CAGGGAGGCTGGAGAACATGGGG + Intronic
1054895948 9:70311318-70311340 GAGAGTGACTGGAGAACAGATGG + Intronic
1055633332 9:78247427-78247449 CAGGGTGGATGGAGTATTTAAGG + Intronic
1057275314 9:93673199-93673221 CAGAGTGGCTGGGGTGCAGGAGG + Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1059972075 9:119678358-119678380 CAGGGAGGCAGGTGGACAGACGG + Intergenic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1060525646 9:124319921-124319943 CAGGGTGACTAGACTTCAGAAGG - Intronic
1060995320 9:127872452-127872474 CAGGGTGGCTGAAGGATGGAGGG + Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061015122 9:127976992-127977014 CAGGGTGGGTGGGGTACGGGTGG + Intronic
1061274442 9:129561415-129561437 CAGGGTGTCTGTGGTACAGGGGG + Intergenic
1061692923 9:132348836-132348858 GAGGATGGCTTGAGTCCAGAAGG + Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1061802113 9:133118382-133118404 CAGGTGGGCTGGAGTGAAGAGGG - Intronic
1061826356 9:133260716-133260738 CACGTTGGCTGGAGCACAGAGGG + Intronic
1062215798 9:135389211-135389233 CAGGGTGGCTGGAGCTCAGGAGG - Intergenic
1062271433 9:135711529-135711551 CAGGGTGCCTGGCGTGCAGCTGG + Intronic
1062404684 9:136389820-136389842 GAGGGTGGCTGGAGTGAAGCTGG + Intronic
1185778890 X:2829083-2829105 GAGGGTGGGTGGCGTACAGCGGG + Intronic
1186496763 X:10016689-10016711 CATTCTGGCTGCAGTACAGAAGG - Intronic
1187140611 X:16589688-16589710 CATGTTTGCTGGAGAACAGAGGG + Exonic
1187565253 X:20443286-20443308 CAGAGTGACTGGGGTACAGGGGG + Intergenic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1188009009 X:25038626-25038648 CAGGATGGCTGGTGCTCAGAAGG + Intergenic
1190430214 X:50371622-50371644 CATGGTGACTGTAGTACAGGGGG - Intronic
1190476643 X:50834603-50834625 CATGGGGTGTGGAGTACAGAGGG - Intergenic
1190700693 X:52987396-52987418 CAGGATGGCTTGAGCCCAGAAGG + Intronic
1191210457 X:57879334-57879356 CAGTGTTGCTGAAGTTCAGATGG - Intergenic
1192431789 X:71117558-71117580 GAGGATCGCTGGAGTCCAGAAGG + Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1194158315 X:90420166-90420188 CAAGGTGGTTGGAGCACAGCTGG + Intergenic
1195914846 X:109925957-109925979 CATGGTGCCTGGTGGACAGAAGG + Intergenic
1196370867 X:114978336-114978358 CAGTGTGGCTGAAAGACAGATGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1196778534 X:119362148-119362170 CAGGGTGGCTGCTGGGCAGAGGG - Intergenic
1198018591 X:132636005-132636027 CAGGGCGTCTGGAGCAGAGAAGG - Intronic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199240143 X:145537494-145537516 CAAGGTGGCTAGAGTTCACATGG + Intergenic
1200504640 Y:3997130-3997152 CAAGGTGGTTGGAGCACAGCTGG + Intergenic
1200688588 Y:6281128-6281150 CAGGGTGACTGGAGCATAGCTGG + Intergenic
1201046685 Y:9893560-9893582 CAGGGTGACTGGAGCATAGCTGG - Intergenic
1201291135 Y:12421421-12421443 GAGGGTGGGTGGCGTACAGCGGG - Intergenic