ID: 1018941231

View in Genome Browser
Species Human (GRCh38)
Location 6:168309871-168309893
Sequence TCCAAACACCAGTGGATCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018941225_1018941231 2 Left 1018941225 6:168309846-168309868 CCAGCGCTTTCAACCCCACTCTC 0: 1
1: 0
2: 0
3: 4
4: 143
Right 1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG No data
1018941224_1018941231 5 Left 1018941224 6:168309843-168309865 CCACCAGCGCTTTCAACCCCACT 0: 1
1: 0
2: 0
3: 9
4: 124
Right 1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG No data
1018941222_1018941231 7 Left 1018941222 6:168309841-168309863 CCCCACCAGCGCTTTCAACCCCA 0: 1
1: 0
2: 0
3: 13
4: 161
Right 1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG No data
1018941219_1018941231 29 Left 1018941219 6:168309819-168309841 CCAGGTGTGAGCCCGGTTCTCTC 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG No data
1018941220_1018941231 18 Left 1018941220 6:168309830-168309852 CCCGGTTCTCTCCCCACCAGCGC 0: 1
1: 0
2: 1
3: 20
4: 199
Right 1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG No data
1018941223_1018941231 6 Left 1018941223 6:168309842-168309864 CCCACCAGCGCTTTCAACCCCAC 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG No data
1018941221_1018941231 17 Left 1018941221 6:168309831-168309853 CCGGTTCTCTCCCCACCAGCGCT 0: 1
1: 0
2: 2
3: 23
4: 248
Right 1018941231 6:168309871-168309893 TCCAAACACCAGTGGATCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018941231 Original CRISPR TCCAAACACCAGTGGATCCA GGG Intronic
No off target data available for this crispr