ID: 1018942503

View in Genome Browser
Species Human (GRCh38)
Location 6:168319056-168319078
Sequence CTGTAACCCTGTAACGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018942496_1018942503 23 Left 1018942496 6:168319010-168319032 CCTCCGCCAGGGGAACGCCGGTC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1018942500_1018942503 6 Left 1018942500 6:168319027-168319049 CCGGTCAGTGCCTGCAGGTCAGA 0: 1
1: 0
2: 0
3: 19
4: 329
Right 1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1018942497_1018942503 20 Left 1018942497 6:168319013-168319035 CCGCCAGGGGAACGCCGGTCAGT 0: 1
1: 0
2: 0
3: 0
4: 36
Right 1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1018942494_1018942503 27 Left 1018942494 6:168319006-168319028 CCGACCTCCGCCAGGGGAACGCC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1018942498_1018942503 17 Left 1018942498 6:168319016-168319038 CCAGGGGAACGCCGGTCAGTGCC 0: 1
1: 0
2: 0
3: 3
4: 62
Right 1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1018942501_1018942503 -4 Left 1018942501 6:168319037-168319059 CCTGCAGGTCAGATCAGTGCTGT 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG 0: 1
1: 0
2: 0
3: 3
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018942503 Original CRISPR CTGTAACCCTGTAACGAACA GGG Intronic
900960378 1:5915239-5915261 CTGTGGCCCTGTTACAAACAGGG + Intronic
905091850 1:35436351-35436373 CTGTAACCCTGACACCAACGCGG - Intronic
909311398 1:74154364-74154386 CTGTAAAATTGTAAAGAACAGGG - Intronic
911945890 1:104108393-104108415 CTGTCACCCTGTGAAGAAGAAGG + Intergenic
913061613 1:115213689-115213711 CTGTAACTCTCTCACGAACTAGG - Intergenic
915276240 1:154790279-154790301 CTGTAATGCTGCAATGAACATGG - Intronic
916328511 1:163590922-163590944 ATGTAAAGCTGTAACAAACATGG + Intergenic
918502641 1:185215587-185215609 CTGTCACCCTGGCACGATCAGGG + Intronic
922047427 1:221960124-221960146 ATGAAGCCCTGTAACTAACATGG + Intergenic
923177685 1:231483359-231483381 CTCTGACCCTGTAACAAAGATGG - Intergenic
924390619 1:243551463-243551485 TTTTAACCTTGTAAGGAACATGG - Intronic
1068680947 10:59819315-59819337 CTTTAACCCTGAAAAGAGCAGGG + Intronic
1070502190 10:77082550-77082572 ATGTAACCCTTTAAGGAACCTGG - Intronic
1072494840 10:95946692-95946714 CTGAAACCCAGTAAGGAAGAAGG + Intergenic
1074529216 10:114285783-114285805 CTCTAACTCTGTGACGAGCACGG + Intronic
1077449439 11:2628078-2628100 CTGTAACACTACAATGAACATGG + Intronic
1087231576 11:95672040-95672062 CTGTATGCCTGCAACGTACAAGG + Intergenic
1087577072 11:100002068-100002090 CTGTAACCGTGAAAGGAAAATGG - Exonic
1099724161 12:86403303-86403325 CTGTAACCATGTAACGCTGATGG + Intronic
1100796235 12:98184746-98184768 CTCTCACCCTGAAACGAATAGGG + Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1110758707 13:79206409-79206431 CTGTCAGCCTGTAATAAACAGGG + Intergenic
1113280698 13:108784131-108784153 TTGTGTTCCTGTAACGAACACGG - Intronic
1117020076 14:51561295-51561317 CCCTAACCCTGTAACAAAGAAGG + Intronic
1120773136 14:88403370-88403392 CTATAATGCTGTAACAAACATGG - Intronic
1121615651 14:95311822-95311844 CTGTATCCCTGGAATGAAGAAGG - Intronic
1131786766 15:95921790-95921812 CTGTAACCCTGTCACAGCCAAGG + Intergenic
1131863836 15:96685286-96685308 GTGTGAACCTGTAACGAAAAAGG + Intergenic
1133153710 16:3856767-3856789 CTGTAACCCAGAAGCAAACAAGG + Intronic
1152411775 17:80128490-80128512 CAGTAACCCTCTCAGGAACAAGG - Intergenic
927376103 2:22416323-22416345 CTGTATCCCTGCAAAGGACATGG - Intergenic
928531282 2:32194922-32194944 CTGTTTCCCTGTAAAGATCAGGG + Intronic
934854584 2:97721275-97721297 CTGAAACCCTAAAACCAACATGG + Intronic
939056327 2:137369203-137369225 CTGTAACCTTGTGAGGAAAAGGG - Intronic
939335378 2:140820384-140820406 CTTTAGCCCTGTAACTGACAGGG - Intronic
944802029 2:203245648-203245670 CTGTATCCCTGCAAAGGACATGG + Intronic
948042506 2:234914359-234914381 CTTTAACCCATTAACGAATAAGG - Intergenic
948500024 2:238385449-238385471 CTGAAAACCTGTAATGAACTAGG + Intronic
1169474095 20:5915443-5915465 TTGCAACCATGTAAAGAACATGG - Intronic
1172919707 20:38471259-38471281 CTGAACCCCTGTAACAGACAAGG - Intergenic
1174739554 20:52998622-52998644 TTGTAACCCTGAAAAGAGCAAGG - Intronic
1183229875 22:36575131-36575153 CTGTAACCCAGTAAGGTAGACGG - Intronic
949615264 3:5746699-5746721 CTGTACGCCAGTAAAGAACACGG + Intergenic
953381152 3:42473761-42473783 CTGTAACCCTGAGAGGAAGACGG + Intergenic
954997922 3:54898795-54898817 CTGTAACTTTGTCATGAACAAGG - Intronic
955921906 3:63966020-63966042 CTGCAACCCTGTAAAAAACCAGG - Intronic
969981444 4:11160431-11160453 GTGCAACCCTGTAACTAACAAGG + Intergenic
975323876 4:73038347-73038369 CTGTAACCCTGTGAGGTATATGG - Intergenic
979004862 4:115281175-115281197 AAATAACCCTGTAATGAACATGG - Intergenic
1006187282 6:32188658-32188680 CTCTAGCCCTATAATGAACAGGG + Intronic
1010519926 6:76819764-76819786 TTGTAACCCTGTAACAGACAAGG - Intergenic
1014320228 6:119918800-119918822 CTGAAATCCTTTAACAAACAAGG + Intergenic
1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG + Intronic
1023083320 7:36545791-36545813 CAGCATCCCTGAAACGAACATGG - Intronic
1027946588 7:84753763-84753785 CAGTAACACTGTAATGATCATGG - Intergenic
1034427069 7:151019547-151019569 CCTTAACCCTGTCACTAACAAGG + Intronic
1036101008 8:5785156-5785178 CAATTACCCTGGAACGAACATGG + Intergenic
1039491242 8:37949031-37949053 CTGTAACCCAGAATCTAACAAGG + Intergenic
1048136733 8:131753351-131753373 CTGGATCCCAGAAACGAACAAGG - Intergenic
1048851348 8:138648189-138648211 CTGGAACCCTGGAAGGAACAGGG - Intronic
1059897605 9:118884580-118884602 CTATATCCCTGTAATGACCAGGG + Intergenic
1062340763 9:136093042-136093064 CTGTGTCCCTGGAACGCACAGGG - Intronic
1188600181 X:31954148-31954170 GTGTAACTCTTTAACGAATATGG - Intronic
1188980367 X:36721684-36721706 CTGTGACCCTGTAAGGACCCGGG + Intergenic
1193611983 X:83644191-83644213 CTGTCACCCAGTAATGATCATGG + Intergenic
1194213724 X:91101224-91101246 CCATATCCCTGTAAAGAACATGG + Intergenic
1201505839 Y:14698943-14698965 CTATAACCCTGTAGTTAACAAGG - Intronic