ID: 1018942547

View in Genome Browser
Species Human (GRCh38)
Location 6:168319266-168319288
Sequence TGGATGGAGGGGACGTCCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 127}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018942547_1018942559 19 Left 1018942547 6:168319266-168319288 CCAAAGGACGTCCCCTCCATCCA 0: 1
1: 1
2: 1
3: 10
4: 127
Right 1018942559 6:168319308-168319330 TAACACACAGTCGCTGCCGAAGG 0: 1
1: 0
2: 0
3: 1
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018942547 Original CRISPR TGGATGGAGGGGACGTCCTT TGG (reversed) Intronic
900206730 1:1434840-1434862 TGGTTGCAGGGGGCGTCCTGAGG - Intronic
900527871 1:3137960-3137982 TGGCTGGAGGGTCCGTCCCTGGG + Intronic
900949401 1:5849449-5849471 TGCATGGAGGGCACGTCTTCAGG - Intergenic
901953928 1:12770550-12770572 TGGGAGTAGGGGACGTTCTTGGG - Intergenic
902045597 1:13521662-13521684 AGGAAGGAGGGGAAGTCCTGAGG - Intergenic
903414368 1:23171584-23171606 TGGAAGGAGGGGAGGAACTTTGG + Intronic
903741885 1:25563097-25563119 AAGAGGGAGGGGACGTCCTGGGG + Exonic
906646676 1:47480134-47480156 AGGATGGAGGGGAGGTCTTAGGG - Intergenic
907570720 1:55480835-55480857 TGGATGGAGGGGACATTCCCTGG + Intergenic
912964772 1:114228013-114228035 TAGCTGGAGGAGACTTCCTTAGG + Intergenic
914353135 1:146857449-146857471 TGGATGGGGGAGACTCCCTTAGG + Intergenic
915592647 1:156879379-156879401 TGGATGCAGGGGAAGGCGTTGGG - Intronic
916682578 1:167117704-167117726 TGGATGGAGGGGCCTTTCTCTGG - Intronic
917203103 1:172538179-172538201 GGAATGTAGGGGACGTACTTTGG + Intronic
917791410 1:178501505-178501527 TGGATGGAGGGGCAGCTCTTAGG + Intergenic
919281624 1:195496428-195496450 TGGATGGAGGGGTGGTTCTCAGG + Intergenic
919811726 1:201412940-201412962 TGGAAGGAGGGGACCTCCCATGG + Intronic
920915399 1:210254252-210254274 TGGATGGAGTGGAAATGCTTGGG - Intergenic
922619843 1:226982811-226982833 TGGGTGGAGGGGACAGACTTGGG + Intronic
922983801 1:229850783-229850805 TGGGTGGAGGGGAAGCCCTTAGG + Intergenic
923856731 1:237853111-237853133 TGCAGGGAGGGAAGGTCCTTTGG - Intergenic
923966425 1:239145383-239145405 TGGATGGTGAGTAAGTCCTTGGG - Intergenic
1062905208 10:1175222-1175244 TGGATGGTGGTTACTTCCTTTGG + Intergenic
1063741742 10:8830014-8830036 TGGAAAGAGGGGAGATCCTTCGG + Intergenic
1067059408 10:43070316-43070338 GGGCTGGAGGGGAAGTCCTGAGG + Intergenic
1070889324 10:79930343-79930365 TGGATGGTGGGGATCTCCTAGGG + Intergenic
1081636152 11:44723615-44723637 TGGATGGATGGGCAGTCCTCAGG - Intergenic
1084678407 11:70650364-70650386 TGGAGGGAGGGGACATGCTGAGG + Intronic
1084738631 11:71123045-71123067 TGGAGGGAGGGGAGCTCCCTGGG - Intronic
1084857944 11:72000818-72000840 TGGGTGGAGGGGCTGGCCTTGGG - Intronic
1085453039 11:76648363-76648385 TGGATGCAGGGGTTTTCCTTGGG - Intergenic
1086550826 11:88049651-88049673 TGGATCGAGGGGACCTCCCTTGG + Intergenic
1086657811 11:89381688-89381710 TGGATCGGGGGGACCTCCCTTGG + Intronic
1089051677 11:115550928-115550950 GGGAGGGAGGGGAGGTGCTTTGG + Intergenic
1089326617 11:117661780-117661802 TGGATGGAGGGGAAGAGCTGAGG + Intronic
1094679965 12:32659177-32659199 TGGAAGGAGGGGAAGTGCTTAGG - Intergenic
1096496475 12:52042026-52042048 GGGATGGAGGGGAAGCCCTGGGG + Intronic
1096568128 12:52498237-52498259 TGGAAGAAGGGGACAACCTTTGG + Intergenic
1102853981 12:116277592-116277614 AGGAAGGAGGGGACGTCGCTCGG - Intergenic
1104658714 12:130593182-130593204 TGGGTGGAGGGTCCCTCCTTGGG - Intronic
1108179812 13:47829439-47829461 GGGCTGGAGGGAACTTCCTTGGG - Intergenic
1112611806 13:100962460-100962482 TGGATGGAGGGGCAGCGCTTAGG + Intergenic
1113454512 13:110438563-110438585 TGGCTGGAGGGGCCGCCCCTGGG + Intronic
1113885803 13:113657890-113657912 TGGATGGCGTGGACGGGCTTCGG - Intronic
1114659974 14:24337875-24337897 TGGAAGGAGGGTCTGTCCTTGGG + Exonic
1126427659 15:48546797-48546819 AGCAGGTAGGGGACGTCCTTGGG + Intronic
1127798097 15:62455269-62455291 TCGATGGAGGGGACGTGATGGGG + Intronic
1132514316 16:359247-359269 GGGATGGAGGGGACCGCCTCTGG - Intergenic
1132785871 16:1656738-1656760 CGGCTGGCGGGGACCTCCTTCGG - Exonic
1135173710 16:20209636-20209658 TGGCAGGAGGGGCTGTCCTTTGG - Intergenic
1135198830 16:20419177-20419199 TGGATAGCGGGGAAGGCCTTGGG - Intronic
1137791230 16:51176423-51176445 TGGAAGGAGGGGACAGCCATGGG - Intergenic
1139980889 16:70858069-70858091 TGGATGGGGGAGACTCCCTTAGG - Intronic
1141179228 16:81741039-81741061 TGGAGGAAGGGGACTGCCTTGGG - Intronic
1148127126 17:45242648-45242670 GGGATGGAGGGGAAGGCGTTTGG - Intronic
1148158153 17:45435151-45435173 TGGAGGGAGGTGAAGCCCTTGGG + Intergenic
1149367483 17:55960354-55960376 TGGATGGAGAGGAAGTTCATTGG - Intergenic
1150270619 17:63862180-63862202 TGGGTGGAGGGGACAGCATTTGG + Intergenic
1150274246 17:63885702-63885724 TGGGTGGAGGGGACAGCATTTGG + Intergenic
1151185834 17:72363349-72363371 TGGCTGGAGAGAACCTCCTTGGG - Intergenic
1151414650 17:73953149-73953171 TGCGTGGAGGGGACTTCCTTCGG - Intergenic
1152285224 17:79408603-79408625 TGGATGGAAGGCAGGTCCCTAGG + Intronic
1152340334 17:79720863-79720885 TGGGTGGTGGAGACATCCTTGGG - Intergenic
1152717391 17:81906611-81906633 AGGATGGCGGGGAGGCCCTTGGG - Intronic
1154138573 18:11802581-11802603 TGGATGGATGGGAAGTCACTGGG - Intronic
1155065582 18:22266282-22266304 TGGAGGGCAGGGACATCCTTGGG - Intergenic
1155759524 18:29548397-29548419 TGGAGGGAGGGGGAGTCTTTGGG + Intergenic
1158552250 18:58446141-58446163 GGGAGGGAGGGCACGACCTTAGG - Intergenic
1159196344 18:65121522-65121544 TGCATGGCTGGGACGGCCTTAGG - Intergenic
1162247983 19:9418732-9418754 TGGATAGAGAGGACCTCCTGGGG - Intronic
1163418346 19:17200572-17200594 AGGATGCAGGGGACCTCCTATGG - Intronic
1165404236 19:35620025-35620047 TGGATGGATGGGAGGACCGTGGG - Exonic
1165427835 19:35755571-35755593 TGGATGGACAGGACGCCCTCGGG + Exonic
1166944318 19:46387728-46387750 TGGAAGGAGGGGAGGTCTTGGGG + Intronic
1168315803 19:55484305-55484327 TGGATGGAGGGCAGGCCCTGAGG - Exonic
928088796 2:28361586-28361608 TGAAAGGATGGGAAGTCCTTGGG - Intergenic
931312497 2:61095827-61095849 TGGATGGAGGGGACATCGCTGGG - Intronic
937247939 2:120505578-120505600 GGGAGGGCGGGGACGTCCCTAGG + Intergenic
937673080 2:124559485-124559507 TGGATGGATGTGACCTCCTTTGG - Intronic
942639353 2:178044960-178044982 TGGCTGCAGGGAATGTCCTTTGG - Intronic
944141253 2:196459561-196459583 TGGAGGGAGGGGACATCATGAGG - Intronic
1168861183 20:1047114-1047136 AGGATGGAAGGGACGTTCTTTGG + Intergenic
1172573334 20:35987178-35987200 TGGCTGGAGGGGAGGGCCTTGGG + Intronic
1172790906 20:37504854-37504876 TGGATGGTGGGGAGGCCCCTGGG - Intronic
1174287377 20:49482838-49482860 TGGAGGGAGGGGCCGCCCCTCGG + Intergenic
1175277397 20:57781508-57781530 TGGATGGAGGGAAGGTTCTAGGG + Intergenic
1178305329 21:31486303-31486325 GGGATGGTGGGGAGTTCCTTGGG - Intronic
1181768917 22:25111745-25111767 GGGGTGGAGGGGGCGGCCTTTGG - Intronic
1181968727 22:26674296-26674318 TAGACTGAGGGAACGTCCTTTGG + Intergenic
1184620151 22:45671367-45671389 TGGGTGGAGGGGACCCTCTTGGG - Intergenic
1185020281 22:48370501-48370523 TGCAAGGAGGGAACGTCCTCTGG - Intergenic
950052452 3:10002887-10002909 TGGGTGGAGGGGAAGGCCATGGG - Intronic
950189933 3:10969658-10969680 AAGATCGAAGGGACGTCCTTTGG - Intergenic
954375218 3:50190989-50191011 TGGAAGCAGAGGACCTCCTTGGG + Intergenic
954997674 3:54896423-54896445 TGTTTAGAGGGGACATCCTTGGG + Intronic
965794856 3:172428981-172429003 TTGATGGAGAGGATGTCTTTGGG + Intergenic
979488558 4:121297542-121297564 AGGATGAAGGGGAAGTGCTTAGG - Intergenic
982078405 4:151762017-151762039 AGGATGGAGTGGATGCCCTTTGG + Intergenic
983087941 4:163470263-163470285 TAGCTGGAGGGGAAGCCCTTAGG - Intergenic
986345342 5:6829852-6829874 GGGATGGAGGGGGCATCCTGAGG - Intergenic
987647918 5:20699948-20699970 TGGAAGGAGGTGAAATCCTTTGG - Intergenic
988603008 5:32656757-32656779 TGGGTGGAAGGGACTTGCTTTGG - Intergenic
994710063 5:103255932-103255954 GGAGTGGAGGGGAGGTCCTTCGG - Intergenic
997607617 5:135186399-135186421 AGGCTGGAGGGGACAACCTTGGG - Intronic
999382048 5:151128138-151128160 TGGCTGGAGGGCATGGCCTTGGG - Intronic
1001477036 5:172057837-172057859 TGGAGGGAGGGGACGTCCTTGGG + Intronic
1002310792 5:178312600-178312622 TTGCTAGAGGGGACGTCCTTGGG - Intronic
1003921495 6:10837873-10837895 TGGAAGGAGGGGGCGTCCCCGGG + Intronic
1004545804 6:16597195-16597217 TGGAAGGAGGAGAATTCCTTTGG + Intronic
1004989085 6:21116948-21116970 GGGATGGAGGGGAAGTACTCTGG - Intronic
1006312040 6:33267803-33267825 TGGGAGGAGGGGACATCCCTGGG - Intronic
1006750810 6:36375764-36375786 GAGATGGAGGGGTCTTCCTTGGG - Intronic
1018650149 6:165986297-165986319 TGGATGGAGGGGAGGGGGTTAGG + Intronic
1018942547 6:168319266-168319288 TGGATGGAGGGGACGTCCTTTGG - Intronic
1022139148 7:27477311-27477333 TGCATGGAGGGGTCCTCCTAAGG + Intergenic
1022196419 7:28071639-28071661 TGGATAGAAGGTCCGTCCTTGGG - Intronic
1023037643 7:36147393-36147415 TGGGTGGAGGGGAAGGCCTCAGG - Intergenic
1025022622 7:55491606-55491628 TGGGTGGTGTGGACTTCCTTAGG - Intronic
1027443204 7:78242344-78242366 TGCATGGAGGGGAGGTGCTCAGG + Intronic
1033118250 7:138645194-138645216 TGCATGGTGGGGAGGTCCTGGGG - Intronic
1035026477 7:155830007-155830029 TGGAAGGAGGGGACGGCCTTTGG - Intergenic
1035268936 7:157708526-157708548 TGGACGGAGGGGCCGTCCCAGGG + Intronic
1040287673 8:46108806-46108828 GGGATGGAAGAGACCTCCTTGGG + Intergenic
1040296121 8:46149952-46149974 GGGATGGTGGGGGCTTCCTTGGG + Intergenic
1040314698 8:46254785-46254807 TGGATGGAAGAGGCCTCCTTCGG - Intergenic
1040330105 8:46381541-46381563 GGGATGGAAGAGTCGTCCTTGGG - Intergenic
1042239321 8:66646744-66646766 TGGATGGAGTGCACGATCTTGGG - Intronic
1044591543 8:93917581-93917603 TGGATGGAGGGGCTGGCCCTCGG + Intronic
1047688873 8:127330389-127330411 TGGGAGGAGGGGAAGTCCTCTGG + Intergenic
1049570849 8:143369637-143369659 GGGAAGGAGGGGACGTCTGTGGG + Intronic
1050017985 9:1255749-1255771 TGGATGTAGGAGCCTTCCTTAGG - Intergenic
1054863782 9:69979224-69979246 TGGGTGAAGGGGAAGACCTTGGG - Intergenic
1057186867 9:93061994-93062016 AGGATGGAGGGGCCGACCTGAGG + Intronic
1058419225 9:104818831-104818853 TGGATGAAGCGGACGTCCTGGGG - Exonic
1188953519 X:36406625-36406647 GGGATGGAAGGGACTTCCTGTGG - Intergenic
1190428228 X:50352596-50352618 TGGATTGTGGGGAGGTCCTGGGG - Intergenic
1199860793 X:151798934-151798956 TGGAGGGAGGGGCCATCTTTTGG + Intergenic
1200036433 X:153334473-153334495 TGGAGGGAGGGGGCGTCTCTGGG + Intronic
1200819666 Y:7569510-7569532 GGGATGGAGGGGATATCATTAGG + Intergenic
1201143369 Y:11046955-11046977 TGGAGGGAGGGGAGCTCCCTAGG - Intergenic