ID: 1018944489

View in Genome Browser
Species Human (GRCh38)
Location 6:168337008-168337030
Sequence CAGGAAAGGATGGCGGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018944489_1018944499 26 Left 1018944489 6:168337008-168337030 CCAGTAGCCGCCATCCTTTCCTG No data
Right 1018944499 6:168337057-168337079 TGCTGCATCCTCAGTAATGAGGG No data
1018944489_1018944498 25 Left 1018944489 6:168337008-168337030 CCAGTAGCCGCCATCCTTTCCTG No data
Right 1018944498 6:168337056-168337078 CTGCTGCATCCTCAGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018944489 Original CRISPR CAGGAAAGGATGGCGGCTAC TGG (reversed) Intergenic
No off target data available for this crispr