ID: 1018949376

View in Genome Browser
Species Human (GRCh38)
Location 6:168369223-168369245
Sequence CAGAAGGAGGGAGGCAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018949376_1018949390 27 Left 1018949376 6:168369223-168369245 CCAGCACTGCCTCCCTCCTTCTG No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data
1018949376_1018949386 23 Left 1018949376 6:168369223-168369245 CCAGCACTGCCTCCCTCCTTCTG No data
Right 1018949386 6:168369269-168369291 CCACCCTGCTCCCCACACCATGG No data
1018949376_1018949388 26 Left 1018949376 6:168369223-168369245 CCAGCACTGCCTCCCTCCTTCTG No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018949376 Original CRISPR CAGAAGGAGGGAGGCAGTGC TGG (reversed) Intergenic