ID: 1018949378

View in Genome Browser
Species Human (GRCh38)
Location 6:168369235-168369257
Sequence GAGCAGTACATACAGAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018949378_1018949386 11 Left 1018949378 6:168369235-168369257 CCCTCCTTCTGTATGTACTGCTC No data
Right 1018949386 6:168369269-168369291 CCACCCTGCTCCCCACACCATGG No data
1018949378_1018949388 14 Left 1018949378 6:168369235-168369257 CCCTCCTTCTGTATGTACTGCTC No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data
1018949378_1018949390 15 Left 1018949378 6:168369235-168369257 CCCTCCTTCTGTATGTACTGCTC No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018949378 Original CRISPR GAGCAGTACATACAGAAGGA GGG (reversed) Intergenic
No off target data available for this crispr