ID: 1018949378 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:168369235-168369257 |
| Sequence | GAGCAGTACATACAGAAGGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1018949378_1018949386 | 11 | Left | 1018949378 | 6:168369235-168369257 | CCCTCCTTCTGTATGTACTGCTC | No data | ||
| Right | 1018949386 | 6:168369269-168369291 | CCACCCTGCTCCCCACACCATGG | No data | ||||
| 1018949378_1018949388 | 14 | Left | 1018949378 | 6:168369235-168369257 | CCCTCCTTCTGTATGTACTGCTC | No data | ||
| Right | 1018949388 | 6:168369272-168369294 | CCCTGCTCCCCACACCATGGTGG | No data | ||||
| 1018949378_1018949390 | 15 | Left | 1018949378 | 6:168369235-168369257 | CCCTCCTTCTGTATGTACTGCTC | No data | ||
| Right | 1018949390 | 6:168369273-168369295 | CCTGCTCCCCACACCATGGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1018949378 | Original CRISPR | GAGCAGTACATACAGAAGGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||