ID: 1018949379

View in Genome Browser
Species Human (GRCh38)
Location 6:168369236-168369258
Sequence TGAGCAGTACATACAGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018949379_1018949388 13 Left 1018949379 6:168369236-168369258 CCTCCTTCTGTATGTACTGCTCA No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data
1018949379_1018949386 10 Left 1018949379 6:168369236-168369258 CCTCCTTCTGTATGTACTGCTCA No data
Right 1018949386 6:168369269-168369291 CCACCCTGCTCCCCACACCATGG No data
1018949379_1018949390 14 Left 1018949379 6:168369236-168369258 CCTCCTTCTGTATGTACTGCTCA No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018949379 Original CRISPR TGAGCAGTACATACAGAAGG AGG (reversed) Intergenic