ID: 1018949388

View in Genome Browser
Species Human (GRCh38)
Location 6:168369272-168369294
Sequence CCCTGCTCCCCACACCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018949377_1018949388 17 Left 1018949377 6:168369232-168369254 CCTCCCTCCTTCTGTATGTACTG No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data
1018949380_1018949388 10 Left 1018949380 6:168369239-168369261 CCTTCTGTATGTACTGCTCAACC No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data
1018949376_1018949388 26 Left 1018949376 6:168369223-168369245 CCAGCACTGCCTCCCTCCTTCTG No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data
1018949375_1018949388 27 Left 1018949375 6:168369222-168369244 CCCAGCACTGCCTCCCTCCTTCT No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data
1018949378_1018949388 14 Left 1018949378 6:168369235-168369257 CCCTCCTTCTGTATGTACTGCTC No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data
1018949379_1018949388 13 Left 1018949379 6:168369236-168369258 CCTCCTTCTGTATGTACTGCTCA No data
Right 1018949388 6:168369272-168369294 CCCTGCTCCCCACACCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018949388 Original CRISPR CCCTGCTCCCCACACCATGG TGG Intergenic