ID: 1018949390

View in Genome Browser
Species Human (GRCh38)
Location 6:168369273-168369295
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018949381_1018949390 -10 Left 1018949381 6:168369260-168369282 CCCTGCACCCCACCCTGCTCCCC No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data
1018949377_1018949390 18 Left 1018949377 6:168369232-168369254 CCTCCCTCCTTCTGTATGTACTG No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data
1018949378_1018949390 15 Left 1018949378 6:168369235-168369257 CCCTCCTTCTGTATGTACTGCTC No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data
1018949380_1018949390 11 Left 1018949380 6:168369239-168369261 CCTTCTGTATGTACTGCTCAACC No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data
1018949379_1018949390 14 Left 1018949379 6:168369236-168369258 CCTCCTTCTGTATGTACTGCTCA No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data
1018949375_1018949390 28 Left 1018949375 6:168369222-168369244 CCCAGCACTGCCTCCCTCCTTCT No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data
1018949376_1018949390 27 Left 1018949376 6:168369223-168369245 CCAGCACTGCCTCCCTCCTTCTG No data
Right 1018949390 6:168369273-168369295 CCTGCTCCCCACACCATGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018949390 Original CRISPR CCTGCTCCCCACACCATGGT GGG Intergenic