ID: 1018951931

View in Genome Browser
Species Human (GRCh38)
Location 6:168384890-168384912
Sequence AATGGGCCCCGGAGACCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018951931_1018951940 30 Left 1018951931 6:168384890-168384912 CCATCTGGTCTCCGGGGCCCATT No data
Right 1018951940 6:168384943-168384965 CGCGCTTGCCGCTGTCCTCACGG No data
1018951931_1018951938 6 Left 1018951931 6:168384890-168384912 CCATCTGGTCTCCGGGGCCCATT No data
Right 1018951938 6:168384919-168384941 ATGTGAGGAGACAAGAGTTTGGG No data
1018951931_1018951934 -9 Left 1018951931 6:168384890-168384912 CCATCTGGTCTCCGGGGCCCATT No data
Right 1018951934 6:168384904-168384926 GGGCCCATTTCTGGAATGTGAGG No data
1018951931_1018951937 5 Left 1018951931 6:168384890-168384912 CCATCTGGTCTCCGGGGCCCATT No data
Right 1018951937 6:168384918-168384940 AATGTGAGGAGACAAGAGTTTGG No data
1018951931_1018951939 7 Left 1018951931 6:168384890-168384912 CCATCTGGTCTCCGGGGCCCATT No data
Right 1018951939 6:168384920-168384942 TGTGAGGAGACAAGAGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018951931 Original CRISPR AATGGGCCCCGGAGACCAGA TGG (reversed) Intergenic