ID: 1018951933

View in Genome Browser
Species Human (GRCh38)
Location 6:168384901-168384923
Sequence CACATTCCAGAAATGGGCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018951933_1018951939 -4 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951939 6:168384920-168384942 TGTGAGGAGACAAGAGTTTGGGG No data
1018951933_1018951940 19 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951940 6:168384943-168384965 CGCGCTTGCCGCTGTCCTCACGG No data
1018951933_1018951937 -6 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951937 6:168384918-168384940 AATGTGAGGAGACAAGAGTTTGG No data
1018951933_1018951943 28 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951943 6:168384952-168384974 CGCTGTCCTCACGGACTCCTGGG No data
1018951933_1018951938 -5 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951938 6:168384919-168384941 ATGTGAGGAGACAAGAGTTTGGG No data
1018951933_1018951942 27 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951942 6:168384951-168384973 CCGCTGTCCTCACGGACTCCTGG No data
1018951933_1018951944 29 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951944 6:168384953-168384975 GCTGTCCTCACGGACTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018951933 Original CRISPR CACATTCCAGAAATGGGCCC CGG (reversed) Intergenic