ID: 1018951935

View in Genome Browser
Species Human (GRCh38)
Location 6:168384907-168384929
Sequence TCTCCTCACATTCCAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018951935_1018951943 22 Left 1018951935 6:168384907-168384929 CCCATTTCTGGAATGTGAGGAGA No data
Right 1018951943 6:168384952-168384974 CGCTGTCCTCACGGACTCCTGGG No data
1018951935_1018951942 21 Left 1018951935 6:168384907-168384929 CCCATTTCTGGAATGTGAGGAGA No data
Right 1018951942 6:168384951-168384973 CCGCTGTCCTCACGGACTCCTGG No data
1018951935_1018951940 13 Left 1018951935 6:168384907-168384929 CCCATTTCTGGAATGTGAGGAGA No data
Right 1018951940 6:168384943-168384965 CGCGCTTGCCGCTGTCCTCACGG No data
1018951935_1018951944 23 Left 1018951935 6:168384907-168384929 CCCATTTCTGGAATGTGAGGAGA No data
Right 1018951944 6:168384953-168384975 GCTGTCCTCACGGACTCCTGGGG No data
1018951935_1018951939 -10 Left 1018951935 6:168384907-168384929 CCCATTTCTGGAATGTGAGGAGA No data
Right 1018951939 6:168384920-168384942 TGTGAGGAGACAAGAGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018951935 Original CRISPR TCTCCTCACATTCCAGAAAT GGG (reversed) Intergenic