ID: 1018951940

View in Genome Browser
Species Human (GRCh38)
Location 6:168384943-168384965
Sequence CGCGCTTGCCGCTGTCCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018951933_1018951940 19 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951940 6:168384943-168384965 CGCGCTTGCCGCTGTCCTCACGG No data
1018951936_1018951940 12 Left 1018951936 6:168384908-168384930 CCATTTCTGGAATGTGAGGAGAC No data
Right 1018951940 6:168384943-168384965 CGCGCTTGCCGCTGTCCTCACGG No data
1018951931_1018951940 30 Left 1018951931 6:168384890-168384912 CCATCTGGTCTCCGGGGCCCATT No data
Right 1018951940 6:168384943-168384965 CGCGCTTGCCGCTGTCCTCACGG No data
1018951935_1018951940 13 Left 1018951935 6:168384907-168384929 CCCATTTCTGGAATGTGAGGAGA No data
Right 1018951940 6:168384943-168384965 CGCGCTTGCCGCTGTCCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018951940 Original CRISPR CGCGCTTGCCGCTGTCCTCA CGG Intergenic
No off target data available for this crispr