ID: 1018951942

View in Genome Browser
Species Human (GRCh38)
Location 6:168384951-168384973
Sequence CCGCTGTCCTCACGGACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018951933_1018951942 27 Left 1018951933 6:168384901-168384923 CCGGGGCCCATTTCTGGAATGTG No data
Right 1018951942 6:168384951-168384973 CCGCTGTCCTCACGGACTCCTGG No data
1018951935_1018951942 21 Left 1018951935 6:168384907-168384929 CCCATTTCTGGAATGTGAGGAGA No data
Right 1018951942 6:168384951-168384973 CCGCTGTCCTCACGGACTCCTGG No data
1018951936_1018951942 20 Left 1018951936 6:168384908-168384930 CCATTTCTGGAATGTGAGGAGAC No data
Right 1018951942 6:168384951-168384973 CCGCTGTCCTCACGGACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018951942 Original CRISPR CCGCTGTCCTCACGGACTCC TGG Intergenic