ID: 1018952132

View in Genome Browser
Species Human (GRCh38)
Location 6:168386117-168386139
Sequence TGCAGTGCATGTGCCCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018952125_1018952132 16 Left 1018952125 6:168386078-168386100 CCAAGCTGCTGGTAGCTGGAGGC No data
Right 1018952132 6:168386117-168386139 TGCAGTGCATGTGCCCGCACAGG No data
1018952130_1018952132 -6 Left 1018952130 6:168386100-168386122 CCTTGGCCGAGGTGGGCTGCAGT No data
Right 1018952132 6:168386117-168386139 TGCAGTGCATGTGCCCGCACAGG No data
1018952122_1018952132 20 Left 1018952122 6:168386074-168386096 CCTGCCAAGCTGCTGGTAGCTGG No data
Right 1018952132 6:168386117-168386139 TGCAGTGCATGTGCCCGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018952132 Original CRISPR TGCAGTGCATGTGCCCGCAC AGG Intergenic