ID: 1018953362

View in Genome Browser
Species Human (GRCh38)
Location 6:168392614-168392636
Sequence TCACATAGTAGGCCTGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018953357_1018953362 -10 Left 1018953357 6:168392601-168392623 CCTCACCTCCTGCTCACATAGTA No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953352_1018953362 12 Left 1018953352 6:168392579-168392601 CCCCCAGCACACCTGTCTTATTC No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953350_1018953362 23 Left 1018953350 6:168392568-168392590 CCTGTCCTCATCCCCCAGCACAC No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953354_1018953362 10 Left 1018953354 6:168392581-168392603 CCCAGCACACCTGTCTTATTCCT No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953348_1018953362 28 Left 1018953348 6:168392563-168392585 CCCGTCCTGTCCTCATCCCCCAG No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953356_1018953362 1 Left 1018953356 6:168392590-168392612 CCTGTCTTATTCCTCACCTCCTG No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953349_1018953362 27 Left 1018953349 6:168392564-168392586 CCGTCCTGTCCTCATCCCCCAGC No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953351_1018953362 18 Left 1018953351 6:168392573-168392595 CCTCATCCCCCAGCACACCTGTC No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953353_1018953362 11 Left 1018953353 6:168392580-168392602 CCCCAGCACACCTGTCTTATTCC No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data
1018953355_1018953362 9 Left 1018953355 6:168392582-168392604 CCAGCACACCTGTCTTATTCCTC No data
Right 1018953362 6:168392614-168392636 TCACATAGTAGGCCTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018953362 Original CRISPR TCACATAGTAGGCCTGGCCA TGG Intergenic
No off target data available for this crispr