ID: 1018953906

View in Genome Browser
Species Human (GRCh38)
Location 6:168395332-168395354
Sequence AGAGCCCATCGGAGGGCCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018953897_1018953906 -2 Left 1018953897 6:168395311-168395333 CCCACACCTGTGTCCACTCCTAG No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data
1018953896_1018953906 -1 Left 1018953896 6:168395310-168395332 CCCCACACCTGTGTCCACTCCTA No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data
1018953895_1018953906 12 Left 1018953895 6:168395297-168395319 CCATTGGGGGTGTCCCCACACCT No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data
1018953893_1018953906 22 Left 1018953893 6:168395287-168395309 CCCTCAGGAGCCATTGGGGGTGT No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data
1018953891_1018953906 25 Left 1018953891 6:168395284-168395306 CCACCCTCAGGAGCCATTGGGGG No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data
1018953899_1018953906 -8 Left 1018953899 6:168395317-168395339 CCTGTGTCCACTCCTAGAGCCCA No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data
1018953894_1018953906 21 Left 1018953894 6:168395288-168395310 CCTCAGGAGCCATTGGGGGTGTC No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data
1018953898_1018953906 -3 Left 1018953898 6:168395312-168395334 CCACACCTGTGTCCACTCCTAGA No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data
1018953889_1018953906 26 Left 1018953889 6:168395283-168395305 CCCACCCTCAGGAGCCATTGGGG No data
Right 1018953906 6:168395332-168395354 AGAGCCCATCGGAGGGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018953906 Original CRISPR AGAGCCCATCGGAGGGCCCA GGG Intergenic
No off target data available for this crispr