ID: 1018955925

View in Genome Browser
Species Human (GRCh38)
Location 6:168410661-168410683
Sequence CGTGCACGGAGCCTGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018955919_1018955925 14 Left 1018955919 6:168410624-168410646 CCACACGTTTCCTCAGGCGTGGA No data
Right 1018955925 6:168410661-168410683 CGTGCACGGAGCCTGGTGAAAGG No data
1018955920_1018955925 4 Left 1018955920 6:168410634-168410656 CCTCAGGCGTGGAATCCAAACAC No data
Right 1018955925 6:168410661-168410683 CGTGCACGGAGCCTGGTGAAAGG No data
1018955915_1018955925 26 Left 1018955915 6:168410612-168410634 CCAGATGGTCACCCACACGTTTC No data
Right 1018955925 6:168410661-168410683 CGTGCACGGAGCCTGGTGAAAGG No data
1018955917_1018955925 15 Left 1018955917 6:168410623-168410645 CCCACACGTTTCCTCAGGCGTGG No data
Right 1018955925 6:168410661-168410683 CGTGCACGGAGCCTGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018955925 Original CRISPR CGTGCACGGAGCCTGGTGAA AGG Intergenic