ID: 1018958295

View in Genome Browser
Species Human (GRCh38)
Location 6:168428029-168428051
Sequence GGCACGTAACCGTGCACTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018958295_1018958297 1 Left 1018958295 6:168428029-168428051 CCAACAGTGCACGGTTACGTGCC No data
Right 1018958297 6:168428053-168428075 CACAGAGTACAGACTTCTCATGG No data
1018958295_1018958299 3 Left 1018958295 6:168428029-168428051 CCAACAGTGCACGGTTACGTGCC No data
Right 1018958299 6:168428055-168428077 CAGAGTACAGACTTCTCATGGGG No data
1018958295_1018958298 2 Left 1018958295 6:168428029-168428051 CCAACAGTGCACGGTTACGTGCC No data
Right 1018958298 6:168428054-168428076 ACAGAGTACAGACTTCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018958295 Original CRISPR GGCACGTAACCGTGCACTGT TGG (reversed) Intergenic