ID: 1018960098

View in Genome Browser
Species Human (GRCh38)
Location 6:168441659-168441681
Sequence TCTGGGGACCCTGCCCGCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018960092_1018960098 -6 Left 1018960092 6:168441642-168441664 CCCGGCTGGGATGGGCTTCTGGG 0: 1
1: 0
2: 3
3: 54
4: 493
Right 1018960098 6:168441659-168441681 TCTGGGGACCCTGCCCGCCGGGG No data
1018960094_1018960098 -7 Left 1018960094 6:168441643-168441665 CCGGCTGGGATGGGCTTCTGGGG 0: 1
1: 2
2: 3
3: 32
4: 310
Right 1018960098 6:168441659-168441681 TCTGGGGACCCTGCCCGCCGGGG No data
1018960090_1018960098 1 Left 1018960090 6:168441635-168441657 CCTGGGACCCGGCTGGGATGGGC 0: 1
1: 0
2: 1
3: 27
4: 321
Right 1018960098 6:168441659-168441681 TCTGGGGACCCTGCCCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018960098 Original CRISPR TCTGGGGACCCTGCCCGCCG GGG Intronic
No off target data available for this crispr