ID: 1018961867

View in Genome Browser
Species Human (GRCh38)
Location 6:168455067-168455089
Sequence TAGGGGCCCCTGCAGGGTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018961861_1018961867 1 Left 1018961861 6:168455043-168455065 CCAGGACAGGAGGGGAGGGCTTG 0: 1
1: 0
2: 3
3: 31
4: 327
Right 1018961867 6:168455067-168455089 TAGGGGCCCCTGCAGGGTGCCGG No data
1018961860_1018961867 2 Left 1018961860 6:168455042-168455064 CCCAGGACAGGAGGGGAGGGCTT 0: 1
1: 0
2: 1
3: 32
4: 339
Right 1018961867 6:168455067-168455089 TAGGGGCCCCTGCAGGGTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018961867 Original CRISPR TAGGGGCCCCTGCAGGGTGC CGG Intronic
No off target data available for this crispr