ID: 1018962914

View in Genome Browser
Species Human (GRCh38)
Location 6:168460971-168460993
Sequence CTGTGTCTGTAGAAGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018962911_1018962914 5 Left 1018962911 6:168460943-168460965 CCTCAGCTCTAAACACAGAGGTT 0: 1
1: 0
2: 1
3: 17
4: 222
Right 1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 180
1018962909_1018962914 12 Left 1018962909 6:168460936-168460958 CCTTGGACCTCAGCTCTAAACAC 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG 0: 1
1: 0
2: 0
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018962914 Original CRISPR CTGTGTCTGTAGAAGTGCCC AGG Intronic
900237859 1:1601003-1601025 CTGTGTATGCAGACGTGGCCGGG + Intergenic
901011952 1:6207170-6207192 CACTGTCTGCAGGAGTGCCCAGG + Intronic
901491727 1:9600127-9600149 TTGTGTCTCTAGATGTGACCTGG - Intronic
901532100 1:9860034-9860056 CTGGATCTGGAGAAGTTCCCTGG - Intronic
903829633 1:26166820-26166842 CTGTGGTTGTATAAGTGCACAGG - Intergenic
903975886 1:27149928-27149950 ATGTGTCTCTAGGAGTGCCAAGG - Intronic
904498986 1:30903253-30903275 CTGAGTCTGCAGAGGTGACCAGG - Intronic
905793848 1:40804280-40804302 CTCTGTCTGTAGAAGGACTCAGG - Intronic
905872970 1:41415579-41415601 TTGTGTCTGTCCAAGTGCCTTGG + Intergenic
905939886 1:41854467-41854489 CTGTGTCTGGAGCACTGCTCAGG + Intronic
906089254 1:43164483-43164505 CTTTTTCTGTAGAAGAGACCTGG - Exonic
906145877 1:43560441-43560463 CTGTGTGTGTAGGTGTGCCTCGG + Intronic
907869493 1:58430503-58430525 CTGTGGCGCCAGAAGTGCCCTGG + Intronic
910578205 1:88791446-88791468 CTGTGTGTGTGGAGTTGCCCAGG + Intronic
911655116 1:100435058-100435080 CTGTGTCTGTGGAACTATCCGGG + Intronic
914196748 1:145451725-145451747 CTGTGTCTGCAGCAGGGCCTGGG - Intergenic
914672779 1:149884368-149884390 CTGTGTCTGTAGAAAAGCGTGGG - Intronic
917691050 1:177469386-177469408 CTTTGTCTGGAGTAGTCCCCAGG + Intergenic
917964791 1:180171698-180171720 ATGTGTCTGTAGGAGAGACCGGG + Intronic
918839031 1:189510366-189510388 GTGTGTCTGTAGCATTGACCAGG + Intergenic
922870035 1:228894902-228894924 CTGTGTCAGTTGAATGGCCCAGG - Intergenic
1063639457 10:7815961-7815983 CAGTCTCAGTGGAAGTGCCCAGG - Intergenic
1064852454 10:19724207-19724229 GTGTGTCTGTAAAACTGCTCAGG - Intronic
1065749434 10:28872173-28872195 TTGTGTGTGGAGAAGTTCCCAGG + Intronic
1066708046 10:38202509-38202531 CTGTGGTTGTATGAGTGCCCCGG - Intergenic
1067099642 10:43325259-43325281 CTGCCTCTGTTGCAGTGCCCCGG - Intergenic
1069557437 10:69407370-69407392 CTGTGTGTGGAGCAGTTCCCAGG - Intronic
1070846242 10:79524430-79524452 CTGTGTCTTTAGAATTTCCCAGG - Intergenic
1070927557 10:80235880-80235902 CTGTGTCTTTAGAATTTCCCAGG + Intergenic
1072608980 10:97004281-97004303 GTGTTTCTGGGGAAGTGCCCAGG - Intronic
1073499797 10:103926155-103926177 CTGTGTCAGCAGAAGGCCCCAGG + Intergenic
1074776039 10:116769102-116769124 CTCTGTCCTTAGAAGTCCCCTGG + Intergenic
1075953321 10:126500903-126500925 CTCTGTTTGTAGAATTGCCCAGG + Intronic
1076411552 10:130255092-130255114 CTGTGGCTGTTGAAGGGGCCTGG + Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1077010585 11:377519-377541 CTGAGGCTGGACAAGTGCCCGGG - Intronic
1077027213 11:446181-446203 CTGTGTCTGTGGCCGCGCCCAGG - Intergenic
1078038023 11:7828282-7828304 CTGTGACTGCAGAAGGGCACAGG + Intergenic
1078823475 11:14905655-14905677 CTCTGTGTGTGGAGGTGCCCTGG - Intronic
1080655777 11:34256964-34256986 CTCTGTGTGTAGATGAGCCCTGG - Intronic
1080845183 11:36020760-36020782 CTGGGTCAGCAGAGGTGCCCTGG - Intronic
1082991525 11:59211190-59211212 CCGTCTCTGAAAAAGTGCCCCGG - Exonic
1084571837 11:69964587-69964609 CAGTGCCTGAGGAAGTGCCCGGG - Intergenic
1088623187 11:111708024-111708046 CTGTGGCTTCAGAAGTACCCTGG + Intronic
1095177654 12:39111595-39111617 GTCTGTGTGTATAAGTGCCCAGG - Intergenic
1096649031 12:53052984-53053006 CTGTCTCTGAAGAGGTCCCCTGG + Intronic
1101409318 12:104456343-104456365 TTCTGTCTGTATAAGTCCCCGGG + Intronic
1101541829 12:105672380-105672402 CTGAGTCTGTTGAATTGCCTTGG + Intergenic
1102618168 12:114172904-114172926 CTGTGTCCGTAGGATGGCCCAGG - Intergenic
1104277722 12:127344967-127344989 CTTTGTATGTAGAAGTACCTGGG - Intergenic
1108911206 13:55553680-55553702 CTTTCTCTGGAGAATTGCCCTGG - Intergenic
1112456179 13:99565853-99565875 CTGGGTCTCTAGAAATGACCTGG - Intergenic
1112985797 13:105447774-105447796 CTGTGACTATATAAATGCCCTGG + Intergenic
1113459331 13:110470939-110470961 CTGTGTCTGTATCAAGGCCCTGG + Intronic
1113468877 13:110530601-110530623 CTGTGTCTGTAGAGGTGGGGCGG - Intronic
1114531373 14:23398680-23398702 TTGTGTCTTCAGAAGTCCCCTGG + Intronic
1116221774 14:42096497-42096519 CTGAGAATGTAGAAATGCCCAGG + Intergenic
1116717779 14:48449351-48449373 CTGTTTCTCTGGAAGAGCCCTGG + Intergenic
1116835814 14:49768253-49768275 CTCTGTCTGCAGGCGTGCCCCGG + Exonic
1118258911 14:64229476-64229498 CTGTGTCTGTAGGGGTGTTCTGG + Intronic
1120733716 14:88030380-88030402 CTGTTTCTGCAGAGGGGCCCAGG - Intergenic
1121741019 14:96252439-96252461 CTGGGTCTGTGCATGTGCCCTGG + Intronic
1122775411 14:104114770-104114792 CTGTGCCTGTAGGAGGGCACCGG + Exonic
1123178119 14:106441379-106441401 CTGTGTCTATAAAACTGCACTGG + Intergenic
1125525488 15:40371471-40371493 CTGTGGCTGTAGAAGAGGCACGG - Intergenic
1125782634 15:42283794-42283816 CTGTGTCTGCAGAAATGGCCAGG + Intronic
1126704007 15:51391028-51391050 CTTTGTCAGTAAAATTGCCCTGG - Intronic
1127797469 15:62451142-62451164 CTGGGTCTGCAGTAGTGCCCAGG - Intronic
1128240630 15:66098839-66098861 CTGTGTCTGTAGTGGGGCTCAGG + Intronic
1132043852 15:98548087-98548109 CTTTGTCTAGAAAAGTGCCCTGG + Intergenic
1132906989 16:2287778-2287800 CTGAGTCAGGGGAAGTGCCCTGG - Intronic
1135222255 16:20623277-20623299 CTGTATCTTTAGAATTTCCCAGG - Exonic
1137379361 16:47983177-47983199 CTGAGTGTGAAGATGTGCCCTGG + Intergenic
1138265357 16:55656288-55656310 CTGTGGCTGTTGAAGTGTCGCGG + Intronic
1140020850 16:71237301-71237323 CTATGACTGCAGAACTGCCCTGG - Intergenic
1141886782 16:86897687-86897709 CTGTGGCTGTGGCAGTGACCTGG - Intergenic
1142177774 16:88652809-88652831 CTGTGACAGAAGCAGTGCCCAGG - Intronic
1143250695 17:5521141-5521163 CTGTCTCTGTAGCAGTGCATGGG - Intronic
1146833624 17:36091870-36091892 TTGTGTCTGGATAACTGCCCGGG + Intergenic
1146848207 17:36198699-36198721 TTGTGTCTGGATAACTGCCCGGG + Intronic
1147130017 17:38402125-38402147 CTGTGTCTGTGTCAGTGCACTGG + Exonic
1147157546 17:38551877-38551899 CTGTGTCTGTTGAGGTGCTGGGG - Exonic
1147446906 17:40480095-40480117 CCCTGTGTGTAGAGGTGCCCAGG + Intronic
1149553932 17:57559769-57559791 CAGTGTCTGCAGAAGGGCCAAGG + Intronic
1150409863 17:64934381-64934403 CTGTGCCTGTGGAAGTCCCTTGG - Intergenic
1151329545 17:73398770-73398792 CTGGGTCTCTGGAAGTACCCGGG - Intronic
1152328691 17:79657915-79657937 CTGTGTCTCCAGGAGGGCCCAGG - Intergenic
1152651072 17:81493234-81493256 TTGTGTGGGCAGAAGTGCCCTGG - Intergenic
1158750147 18:60249447-60249469 CTGTGTGTATACAAGTGCCATGG - Intergenic
1160321411 18:77899927-77899949 CAGTGTCTGCAGCAGTGGCCTGG - Intergenic
1162252741 19:9459967-9459989 CTGTGTCGGTAGAAGGGCTGAGG - Intergenic
1164825472 19:31282106-31282128 CACTGTCTGCAGAAGTGCACCGG + Intronic
1165118920 19:33546618-33546640 CTTTGGCTGTAGAATTGACCAGG + Intergenic
1166141063 19:40805579-40805601 TTGTGTCTGCAGAAGTGGCTGGG + Intronic
1166743249 19:45126794-45126816 CTGTGCATGTAGCAGTGACCAGG + Intronic
924990074 2:306640-306662 CTGTGTGTGTATTAATGCCCCGG - Intergenic
926305764 2:11636643-11636665 CTGAGTCTGTGGGAGTCCCCAGG + Intronic
926798849 2:16641120-16641142 CTGTGTGTGCAGAACTGTCCAGG - Intronic
927206230 2:20612515-20612537 CTGTCTCTGTAGATTTGTCCTGG + Intronic
927452829 2:23223626-23223648 CTGTGTCTGTGTAACTGCTCTGG - Intergenic
933237012 2:79875127-79875149 CTGTTTCTGTAGGTGTGTCCTGG + Intronic
937468239 2:122153665-122153687 CTGTGACTTTTGGAGTGCCCTGG - Intergenic
940119668 2:150250231-150250253 TTGTGTCTGTTGGAGGGCCCTGG + Intergenic
942297126 2:174528454-174528476 CTGTGAATGTACAAGTGCCATGG + Intergenic
943005450 2:182383969-182383991 CTGAGCCTGTAGAAATGCCTTGG + Intronic
947644158 2:231725981-231726003 GTGAGTTTGTGGAAGTGCCCTGG + Intergenic
948311160 2:236987866-236987888 CTGTGTCTCTCCAAATGCCCAGG + Intergenic
948727699 2:239944956-239944978 CTGTGTCTGGAGATGAGCTCTGG - Intronic
948844974 2:240678750-240678772 CTGTGTCTGAAATAGTGTCCTGG - Intronic
948848886 2:240696129-240696151 CTGTGTCTGAAATAGTGTCCTGG + Intronic
1169215104 20:3789022-3789044 CTTTGCCTGTAGCAGTGCACGGG + Intronic
1172102713 20:32495179-32495201 CTGTGGCTGAGGAAGTGCCCAGG - Intronic
1175945252 20:62555620-62555642 CTGTGGCTGGAGCAGTGCCAAGG - Intronic
1176233922 20:64045444-64045466 CTGTGTCTGTGGGAGTTGCCGGG + Intronic
1179481382 21:41680948-41680970 GTGGGTCTGGAGAAGGGCCCTGG + Intergenic
1182712089 22:32329537-32329559 CTGTGTCTGTTGAGGGGCTCTGG + Intergenic
1182932919 22:34192060-34192082 CTGTGACTGTACAAGTTTCCTGG - Intergenic
1185008347 22:48299094-48299116 ATGTGTCTGGAAAAATGCCCAGG + Intergenic
952953670 3:38543646-38543668 CTCTGCCTGTAGGAGTGCCTGGG + Intergenic
953586301 3:44204310-44204332 CTGTGTTGGTGGAAGTACCCAGG - Intergenic
955411736 3:58659918-58659940 CTCTGTCTGCAGAATTTCCCGGG - Intronic
955879384 3:63527525-63527547 CTCTGTCTGCAGAGGTGCTCAGG - Intronic
956265467 3:67391776-67391798 CTGTGTCTGATGATGTCCCCTGG + Intronic
956740740 3:72273817-72273839 CTGGGTCTGTAATAGGGCCCTGG - Intergenic
961623820 3:128245378-128245400 CTGTGGCTGTAGCAGAGACCTGG + Intronic
962604404 3:137021239-137021261 CTCTGTCTATTGAAATGCCCAGG + Intergenic
962663647 3:137631469-137631491 CACTGTATGTAGAAGTGGCCAGG + Intergenic
962739598 3:138353433-138353455 CTGTGTCTCTAGAAGGGTCCAGG - Intronic
964739394 3:159949715-159949737 CTTTGTCTGTCTGAGTGCCCTGG - Intergenic
965802811 3:172512052-172512074 GTGTGTGTGTATAAGTGCACTGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
969615192 4:8247893-8247915 CTGTGCCGGGGGAAGTGCCCTGG + Intergenic
970065363 4:12087674-12087696 CTCTGCCTGCAGAAGGGCCCAGG + Intergenic
970939659 4:21616482-21616504 CTGTGTCTCTATTAGTGTCCTGG + Intronic
972977080 4:44649180-44649202 CTGGTTCTCAAGAAGTGCCCTGG + Intronic
973122968 4:46545619-46545641 CTGTGACAGTAGAAGAGGCCAGG - Intergenic
975234502 4:71976236-71976258 CTGAGTCTGGAAAAGTGCCCGGG + Intergenic
976610282 4:87023951-87023973 CTCTGTCCTTAAAAGTGCCCAGG - Intronic
979342668 4:119545270-119545292 CTCTATCTGTAAATGTGCCCAGG - Intronic
980892167 4:138827569-138827591 CTGTGTCTGTGGAGGGGCCTGGG - Intergenic
982431001 4:155321903-155321925 CTATGTCTATACAAGTGCCTGGG - Intergenic
982847384 4:160271061-160271083 CTGTTTCTCTAGAACTACCCCGG - Intergenic
983177937 4:164613671-164613693 TTGTATCTGTAGAAGTGCCAAGG - Intergenic
984282209 4:177683986-177684008 CTGTGACTGGAGAAGAGCACAGG - Intergenic
985922122 5:2985649-2985671 CTGTGTCTGTCCAGGTTCCCAGG - Intergenic
986637602 5:9838208-9838230 GAGTATCTGTAAAAGTGCCCAGG + Intergenic
989408665 5:41091710-41091732 CTGAGTCTGTAGGTGTGGCCTGG - Intergenic
989998258 5:50861294-50861316 CTGTGTCTGTTGATGTTTCCAGG + Intergenic
991607785 5:68420699-68420721 CTGCTTCTGTGGAAGTGACCAGG + Intergenic
996527486 5:124494085-124494107 CTGTGGCTGGAGAAGTGCATGGG + Intergenic
999101493 5:149029261-149029283 CTGTGTTTGTAAAAGTGGCAGGG + Intronic
999353976 5:150906138-150906160 CAATTTCTGTAGAAATGCCCTGG - Intergenic
1000237673 5:159377375-159377397 CTGTGTCTGCAGTAGTGTGCCGG - Intergenic
1004140193 6:13011028-13011050 ATGTGTGTGAAGAAGGGCCCAGG - Intronic
1004162787 6:13229600-13229622 CTGTGTCTGCAGAAGTTCAGCGG - Intronic
1005317845 6:24621438-24621460 CTGTGTCTCTGGATGTCCCCTGG - Intronic
1006210917 6:32393981-32394003 CTGTGGCTGTAGGCCTGCCCAGG - Exonic
1006365574 6:33613250-33613272 CTGTGACTGTGAAGGTGCCCCGG + Intergenic
1007136791 6:39530146-39530168 CTGTGTATATAGAAAGGCCCAGG - Intronic
1010559559 6:77333178-77333200 CTGGGTCTGGAGATGTGCCTGGG - Intergenic
1013596643 6:111666489-111666511 CTGTCTCTCTAGAATTGCTCAGG + Intronic
1016029256 6:139321126-139321148 CTGTCAGTGTAGAAGTGCCCCGG + Intergenic
1016608729 6:145964199-145964221 CTGGGTCTGTAGAGGAGCGCAGG - Exonic
1016908327 6:149173017-149173039 CTGTGACTGCTGAAGTCCCCAGG + Intergenic
1018393522 6:163359283-163359305 CTGTGTCCGCAGAACTTCCCTGG - Intergenic
1018962914 6:168460971-168460993 CTGTGTCTGTAGAAGTGCCCAGG + Intronic
1019624087 7:2007012-2007034 CTCTGTCTGTGGCACTGCCCCGG - Intronic
1020153171 7:5699631-5699653 CTGTTTCTGTACAATTCCCCTGG - Intronic
1020490292 7:8774268-8774290 CTGTTTTTGTACAAGTGCCATGG + Intergenic
1020849143 7:13327870-13327892 CTATGCCTGGAGAACTGCCCAGG - Intergenic
1021627073 7:22603847-22603869 AAGTGTCTCTAGAAGTTCCCAGG + Intronic
1023661245 7:42473151-42473173 CTGAGACTGAAGAAGTTCCCCGG + Intergenic
1024564595 7:50671116-50671138 CTGTGTGTCCAGGAGTGCCCTGG - Intronic
1026371740 7:69706323-69706345 CTGTGTGTGTTGGAGGGCCCAGG + Intronic
1031504236 7:122561111-122561133 CTGTGTCTGTAAGAGTGAGCAGG - Intronic
1034060632 7:148084299-148084321 CTGTGACTGAGGAAGAGCCCTGG - Intronic
1040799621 8:51326002-51326024 CTGTGTCTGTTGATGTGCTCAGG + Intronic
1040880515 8:52199861-52199883 CTGTGACAGCAGAAGTTCCCTGG + Intronic
1041714791 8:60923252-60923274 CTGTGTCTGCAGAGGGGCCCGGG - Intergenic
1049439767 8:142603982-142604004 CTTTCTCAGTTGAAGTGCCCAGG + Intergenic
1049455127 8:142682774-142682796 CTGTGTCTGGACCAGGGCCCTGG + Intergenic
1049490538 8:142898224-142898246 CTGTGTTTACAGGAGTGCCCTGG + Intronic
1055134908 9:72817417-72817439 CTGTGTCAGTAGACGTTCCTCGG - Intronic
1058204656 9:102088241-102088263 CTGTTTCTGTAGAAGTATGCAGG + Intergenic
1060863108 9:126972596-126972618 CTGTGTCTGATGAAGTCCCTGGG + Intronic
1062475400 9:136724239-136724261 CTGTGTTTGGGGAACTGCCCTGG - Intergenic
1062571240 9:137186351-137186373 CTGTGTCTAGAGGAGAGCCCTGG + Exonic
1062697984 9:137885109-137885131 CTGTGTCTGCAGCAGGGCCTGGG + Intronic
1185946470 X:4382549-4382571 CTGTGACTGTAGAAATACACAGG - Intergenic
1186851858 X:13588388-13588410 CTTTGTCTGTTAAAGAGCCCAGG + Intronic
1187077225 X:15947250-15947272 CTTTCTCTGGAGAATTGCCCTGG + Intergenic
1189995469 X:46633202-46633224 CTCTGTCTGTGGCAGGGCCCAGG - Intronic
1199332990 X:146583462-146583484 CTGTATCTGTAGTAAAGCCCTGG + Intergenic
1201578189 Y:15483104-15483126 CAGTGGCTGAAGAAGTTCCCAGG - Intergenic
1201733686 Y:17233949-17233971 CTGTGACTGTAGAAATACACAGG - Intergenic