ID: 1018963055

View in Genome Browser
Species Human (GRCh38)
Location 6:168462389-168462411
Sequence ATCGTTTCCCGGCATCCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 55
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 52}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018963053_1018963055 -2 Left 1018963053 6:168462368-168462390 CCTGAGTCTGTATGTTGAATTAT No data
Right 1018963055 6:168462389-168462411 ATCGTTTCCCGGCATCCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 52
1018963052_1018963055 12 Left 1018963052 6:168462354-168462376 CCTTGTTGGAACTGCCTGAGTCT 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1018963055 6:168462389-168462411 ATCGTTTCCCGGCATCCTGCTGG 0: 1
1: 0
2: 0
3: 2
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018963055 Original CRISPR ATCGTTTCCCGGCATCCTGC TGG Intronic