ID: 1018964227

View in Genome Browser
Species Human (GRCh38)
Location 6:168471660-168471682
Sequence GAGTCCTTGTATATTCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018964227 Original CRISPR GAGTCCTTGTATATTCTGGT GGG (reversed) Intronic
908961904 1:69708319-69708341 CAGTCCTTGTAGACTGTGGTAGG - Intronic
909992662 1:82241722-82241744 GAGTCTTTGTAAATTCTGAGAGG - Intergenic
913074494 1:115330285-115330307 GAGTGATTATATATTCTGGATGG - Intronic
913441306 1:118900858-118900880 GAATCCTAAGATATTCTGGTGGG - Intronic
915319689 1:155049885-155049907 GAGTCTTTGCACATTCTGCTTGG - Intronic
915447290 1:155981008-155981030 TGGACCTTGTATATTCTGGGAGG + Intronic
922699253 1:227748933-227748955 GAGTCCTGCTATCTTCTGTTTGG + Intronic
1065083566 10:22151514-22151536 GATTCCTTTTGTATTCTGGGTGG + Intergenic
1065206737 10:23364141-23364163 ATGTCGTTGTTTATTCTGGTTGG + Intergenic
1068737004 10:60425155-60425177 GAGTCTTTGTATATTCAGGTAGG + Intronic
1072166547 10:92818896-92818918 GGGCCCTTGTATCTTCTAGTTGG + Intergenic
1073754112 10:106562595-106562617 GAGTCTTTTTTTTTTCTGGTGGG - Intergenic
1074948202 10:118302001-118302023 AAGACCTTGTATCTTCTGATGGG - Exonic
1075897217 10:126007092-126007114 GAGTCTTTCCATATTCTGGCAGG + Intronic
1077838916 11:5951819-5951841 GTCTCTTTATATATTCTGGTGGG + Intergenic
1078348097 11:10569336-10569358 AACTCCTTTCATATTCTGGTAGG + Intronic
1079048868 11:17134935-17134957 GACTCCATGCAAATTCTGGTAGG - Exonic
1080652819 11:34236110-34236132 AAGTCCGTGGATATTCTTGTTGG + Intronic
1080942807 11:36938624-36938646 GAGGCCTGGTATCTTCTTGTCGG + Intergenic
1085729200 11:78982183-78982205 TAATCCTTGCATCTTCTGGTTGG + Intronic
1086607506 11:88713726-88713748 GAGTACCTGTATATGCTGGCAGG - Intronic
1089043322 11:115474957-115474979 GAATCCCTATATATTGTGGTGGG + Intronic
1090539284 11:127682699-127682721 GAGTGCTTGAATATCATGGTCGG - Intergenic
1096314476 12:50552021-50552043 GAGCCCTTGTGCATGCTGGTGGG - Intronic
1097346136 12:58494866-58494888 GCTTTCTTGTATATTCTTGTTGG + Intergenic
1099854819 12:88150622-88150644 GTTTCCTTGTATTTTCTGATGGG + Intronic
1101649751 12:106666574-106666596 TAGTCCTTGGATGTTCTGTTCGG + Intronic
1102909802 12:116704442-116704464 GAATCCTTGTACATTGTGGGTGG + Intergenic
1104793126 12:131496467-131496489 GTGTCCTTGCCCATTCTGGTTGG - Intergenic
1107693171 13:42972806-42972828 GAGTGGTTGGATATTCTCGTGGG - Intronic
1112436723 13:99395889-99395911 AAATCCTTGGACATTCTGGTTGG + Intergenic
1115093606 14:29607895-29607917 GAGTCTTTGTATGGTGTGGTAGG - Intronic
1115272255 14:31566563-31566585 GAGTCCTTATATGGTTTGGTAGG + Intronic
1116723852 14:48535838-48535860 TAGTTCTTGGATATTCTGGTCGG + Intergenic
1117660704 14:58001515-58001537 GAATCCTTGTATACTGTGGGTGG - Exonic
1120687563 14:87555511-87555533 GTGTTCTTGTATATTTTGGATGG - Intergenic
1121684362 14:95822634-95822656 GAGTTTTTGTATATTCTTGATGG - Intergenic
1121907566 14:97761041-97761063 GGGTGCTGGTATACTCTGGTTGG + Intronic
1125677879 15:41512143-41512165 GAGTCGCTGTACATCCTGGTGGG - Exonic
1126847396 15:52773606-52773628 GAGCCCTGGTTTATCCTGGTGGG - Intronic
1128760120 15:70210798-70210820 GAGTCCTTGGAAATACTGATGGG - Intergenic
1129869210 15:78929981-78930003 GAGTTTTTGTTTATTCTGGGAGG - Intronic
1135090252 16:19508551-19508573 GTGTCCTTTTTTATTTTGGTGGG - Intronic
1141039361 16:80658778-80658800 GAGCCCTTGTTTATTTTAGTGGG - Intronic
1145323795 17:21782401-21782423 GCGTCCTGGTACATTGTGGTGGG - Intergenic
1153245485 18:3069147-3069169 AATCACTTGTATATTCTGGTGGG - Intronic
1153322039 18:3783032-3783054 GAATCTTTGTATATGCTTGTTGG - Intronic
1154093777 18:11390759-11390781 CAGTCCTTGTATATACTGATAGG + Intergenic
1157073425 18:44437184-44437206 CATTCCTTGGATATTCTGTTTGG + Intergenic
1160478930 18:79220432-79220454 GAATCTTTGTATTTTTTGGTAGG - Intronic
1167832327 19:52035461-52035483 GAATCCTTTTATAATCTTGTTGG + Intronic
931187908 2:59971603-59971625 GAGTCCTTGCATTTATTGGTAGG + Intergenic
932612777 2:73212153-73212175 GAGTCCTTGTCTTTGCTGCTGGG - Exonic
933207025 2:79518575-79518597 GAGTCCTTGTGGTTTCTGGGTGG - Intronic
939359800 2:141155974-141155996 GAGTCCTTTTATGTTCCTGTAGG - Intronic
941995589 2:171599201-171599223 GAACCCTTATACATTCTGGTGGG - Intergenic
942776701 2:179590441-179590463 GAATACTAGTATATTCTGGATGG - Intronic
942833557 2:180265445-180265467 AAGTCCTTCTATATTGTGGATGG - Intergenic
943193008 2:184704872-184704894 GAATCCTTGTAGACTCTGCTTGG + Intronic
1169678451 20:8181596-8181618 GAATCCTTGTATATACTTCTAGG - Intronic
1173262923 20:41452432-41452454 GACTCCTTGTATATCCTTGCGGG + Intronic
1174700504 20:52603641-52603663 GGGTCCTTCTGTCTTCTGGTGGG + Intergenic
1175696204 20:61105136-61105158 GTGTCCTTGTATTTTCTGGGTGG + Intergenic
1180846165 22:18983595-18983617 GAGGCCCTGCATACTCTGGTGGG - Intergenic
1181117256 22:20640226-20640248 AAGTTCTTGTATATTATAGTAGG + Intergenic
1184303565 22:43578570-43578592 GTGTCCTTGGATATTGTGCTTGG - Intronic
949445767 3:4132117-4132139 GAGTAAGTGTTTATTCTGGTGGG - Intronic
951166417 3:19488748-19488770 GAATCCTTATATATTCTTGGGGG + Intronic
952223916 3:31354035-31354057 GAATCCTTGTATATTCAGTGAGG - Intergenic
956275855 3:67500290-67500312 AAGTGCTTGAATATTGTGGTAGG - Intronic
957227857 3:77472857-77472879 GAACCCTTGTATATTTTGTTGGG + Intronic
960128868 3:114031411-114031433 TATTCTTTGTATACTCTGGTGGG - Intronic
963145118 3:141985878-141985900 CATTCCTTGTATATTCTAGATGG - Intronic
970983864 4:22132247-22132269 GAATCCTTGTATATTGTTGGTGG - Intergenic
974618282 4:64319542-64319564 GAGTCCTTGTATATGTGGTTTGG - Intronic
974825764 4:67127614-67127636 AAGTCCTTATATTTTCTGTTCGG - Intergenic
974969947 4:68810543-68810565 GAGTCCCTGTATATGCTGCAAGG - Intergenic
978483312 4:109220113-109220135 GAGTCTTTGTATATTCTATAAGG + Intronic
978994089 4:115128568-115128590 GAGTGCTTATATACTCTTGTTGG - Intergenic
979578797 4:122330337-122330359 GAATCCTTGCATATTTTGGTAGG - Intronic
981276828 4:142909553-142909575 GAGTTCTGGTATGTTCTGGGTGG + Intergenic
981317366 4:143352489-143352511 GAGTCCTTGTGTCATTTGGTTGG + Intronic
983139838 4:164136493-164136515 GAGCCCCTGAGTATTCTGGTGGG - Intronic
984475793 4:180232761-180232783 GATTCCCTGTACATTCTGTTGGG + Intergenic
987850311 5:23344230-23344252 GAGTCCTGGTATATTGTTGGTGG + Intergenic
992033496 5:72747980-72748002 CAGTTCTTGAATATTCTGGGGGG - Intergenic
994588511 5:101742978-101743000 GAGTCCATGTGTTTTTTGGTAGG + Intergenic
1008641098 6:53463479-53463501 GAGTCCTTGAAAAGACTGGTTGG + Intergenic
1011118585 6:83924694-83924716 GGGTCCTTGTATCTACTGCTAGG + Intronic
1012288665 6:97423874-97423896 GAGTAAGTGTCTATTCTGGTAGG + Intergenic
1013005304 6:106067413-106067435 GAGTCCTTGTCAATTCTTTTGGG - Intergenic
1013791389 6:113840745-113840767 GAGTACATATATATTCGGGTTGG - Intergenic
1013988652 6:116227577-116227599 GAATCCTTGTACATTCTTGGTGG - Intronic
1015854609 6:137610059-137610081 GCATCCTTGTACATTCTGATTGG + Intergenic
1018368624 6:163147875-163147897 GAGTCCATTTCTATTCTGGTTGG - Intronic
1018964227 6:168471660-168471682 GAGTCCTTGTATATTCTGGTGGG - Intronic
1028645017 7:93086482-93086504 TAGTCCTTGTATGTTCTCTTGGG + Intergenic
1030233960 7:107238609-107238631 GAACCCTTGTATACTGTGGTTGG - Intronic
1032447073 7:131993445-131993467 GAATCCTTGTGCATTTTGGTGGG + Intergenic
1034369355 7:150581182-150581204 GATTCCTTGTATCTCATGGTTGG + Intergenic
1037642825 8:20763652-20763674 GCGTCCTTTTATATACTTGTTGG - Intergenic
1038578017 8:28722104-28722126 GAGGCCATGTAAATTCTGGAGGG + Intronic
1041117762 8:54556645-54556667 GAATCCTTGTATATTGTTGGTGG + Intergenic
1041424972 8:57710501-57710523 GATTCCTTGTATATAATAGTTGG + Intergenic
1042718344 8:71800397-71800419 ATGTCCTTGTATATGTTGGTGGG - Intergenic
1044937437 8:97306634-97306656 CAGTCATTGTTTATTGTGGTAGG - Intergenic
1050817225 9:9830935-9830957 GAGTTCTTGCATATTCTTGAGGG - Intronic
1051718341 9:20008941-20008963 GAGTTCTTGGATATTCAGGATGG - Intergenic
1058285952 9:103178382-103178404 CATTCCTTGGATATTCTCGTGGG + Intergenic
1059009541 9:110441749-110441771 GAGTCCTTTTGTCCTCTGGTTGG + Intronic
1060537292 9:124400330-124400352 GCGTCCTTGTATTCTCTAGTGGG + Intronic
1061335089 9:129928055-129928077 AAGTCCTTGTAAATTATAGTTGG - Intronic
1061456131 9:130699215-130699237 CAGTGCTTGAATATTGTGGTTGG + Intronic
1061818715 9:133210801-133210823 GTGTCCTTTTAGATACTGGTTGG + Intergenic
1187852775 X:23607384-23607406 CTCTCATTGTATATTCTGGTTGG - Intergenic
1188240227 X:27777630-27777652 GAGGCCTTGTATAGTGTTGTAGG + Intergenic
1193877926 X:86884826-86884848 GAACCCTTGTATGTTCTGGGTGG + Intergenic
1194692377 X:97003415-97003437 GAAGCCTTGTATATTGTTGTTGG - Intronic