ID: 1018965303

View in Genome Browser
Species Human (GRCh38)
Location 6:168481308-168481330
Sequence ACATAGTAGCAGAATGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018965303 Original CRISPR ACATAGTAGCAGAATGAACA GGG Intronic
900280394 1:1863578-1863600 ACAGAGTAGCAGCATGTAGAAGG - Intronic
900692602 1:3990054-3990076 ACATGGCAGCAGAAAGAAAATGG - Intergenic
901517207 1:9756352-9756374 ACAAAGTAGGAGAATAAATAAGG + Intronic
901748673 1:11392141-11392163 AGAGAGGAGCAGAATGAAGAAGG - Intergenic
902882213 1:19379824-19379846 AGAAAGTAGCAGAATTAAAAAGG + Intronic
903411898 1:23151509-23151531 ATAGAGGAGCAGAAAGAACATGG + Intronic
904883666 1:33719617-33719639 ACATAGGAGCAGAAAGAGCAGGG + Intronic
906650571 1:47509528-47509550 ACACAGTAGGAGAGTGACCAGGG - Intergenic
909583826 1:77266890-77266912 ACAGGGAAGCAGAATGAAGAAGG + Intergenic
910166322 1:84331568-84331590 ATTTTGTAGCATAATGAACAGGG + Intronic
912206720 1:107517019-107517041 ACATAGTAGCAGAAAGGAGTTGG - Intergenic
912489307 1:110052991-110053013 ACAGAGGAGGAGAATGAAAAAGG - Intronic
915253685 1:154608894-154608916 ACATAGTAGGAGCATTAACAAGG - Intronic
916392979 1:164352686-164352708 AAATATTAGCAGAATGTAAAGGG + Intergenic
916851056 1:168704070-168704092 ACAAGGAAGCAGAATGATCAGGG + Intronic
918236669 1:182586918-182586940 ACAGAGCAGCAGTATGAAGAAGG + Exonic
919390914 1:196984803-196984825 ACATAGTAGCAGAGAGAAAGTGG - Intronic
919582543 1:199394605-199394627 ACACATTATCTGAATGAACATGG - Intergenic
920694453 1:208171439-208171461 CCATTGTAGCAGAAGGAAAATGG + Intronic
920832107 1:209474880-209474902 GCACAGCAGGAGAATGAACAGGG + Intergenic
923187944 1:231592084-231592106 AAAAAGCAGCAGAATGAATATGG - Intronic
1063808714 10:9679157-9679179 TCATAATAGTAGAATGAACTGGG + Intergenic
1064726254 10:18282725-18282747 ATATACTAGGTGAATGAACAAGG - Intronic
1065333875 10:24634685-24634707 ACAAAGTAGCAAAATGATGAAGG - Intronic
1067187642 10:44043981-44044003 AAATAATTGCGGAATGAACAAGG - Intergenic
1068212705 10:53941916-53941938 ACTTAATAGAAGAATGTACACGG + Intronic
1069077021 10:64048851-64048873 GAATAGTACCACAATGAACATGG - Intergenic
1070121848 10:73585195-73585217 AAATAGTAGCAAAATTAAGAGGG + Intronic
1072275633 10:93820001-93820023 ACATAGTAGGGGAAGGAAAAAGG + Intergenic
1072304677 10:94095851-94095873 ACACAGAAGTAGAAGGAACATGG - Intronic
1072875935 10:99173367-99173389 ACCTAGTAGCCAAATGAATATGG + Intronic
1073923457 10:108485621-108485643 ACAGAGTGGCAGAATGGATAAGG - Intergenic
1075158399 10:120000947-120000969 ACATGGTAGCCCAATCAACAGGG + Intergenic
1075498468 10:122950075-122950097 ACAGAGTAGCAAAATGGAAAGGG + Intronic
1076536823 10:131183765-131183787 ACAGAGTAGGAGACAGAACAGGG - Intronic
1079145971 11:17852210-17852232 ACTTAGTAGCTGAATGACCTTGG - Intronic
1079661996 11:23050076-23050098 AGCTAGTAGCATACTGAACAGGG - Intergenic
1079667501 11:23125030-23125052 ACATAGGATAACAATGAACAAGG - Intergenic
1079668729 11:23139321-23139343 AAAAAGTAACAGTATGAACAAGG - Intergenic
1079777907 11:24557365-24557387 ACATAGGAGCAGGATGATTATGG + Intronic
1079805652 11:24927453-24927475 ACATAATAGGAGAATGAAACTGG - Intronic
1081660773 11:44887053-44887075 ACAAAGTACCAGAGTGAAAAAGG + Intronic
1083514727 11:63246337-63246359 ACAGAGAAGCAGGGTGAACAGGG + Intronic
1085749730 11:79150987-79151009 ACATAGTAGCTGAGTGATCCTGG - Intronic
1086630145 11:89007477-89007499 AAATAGCAGCAGAATGATAATGG - Intronic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1088641138 11:111874007-111874029 AGAAAGTAGCAGAAAGAACATGG + Intergenic
1088944324 11:114494463-114494485 TCTTAGTAGCAAAATGATCAAGG - Intergenic
1090186134 11:124740203-124740225 ACCTAGGAGCAGAAAGAAAAGGG + Intronic
1091159071 11:133402992-133403014 ATATAGTCACAGAAAGAACATGG - Intronic
1091237550 11:134032274-134032296 AGAGAGCAGGAGAATGAACATGG + Intergenic
1091306894 11:134542031-134542053 ACAGTGTGGCAGAAGGAACATGG + Intergenic
1091960779 12:4692349-4692371 ACATGGTAGGAGTAGGAACAAGG - Exonic
1095535344 12:43239678-43239700 ACACAGAAGCAGCAAGAACATGG - Intergenic
1095568364 12:43653146-43653168 ACATAGTAGCTCTCTGAACATGG + Intergenic
1095568530 12:43654813-43654835 ACATAGTAGCTCTCTGAACATGG - Intergenic
1095579178 12:43776207-43776229 TCTTACTAGCAGAATGAACTTGG + Intronic
1097368249 12:58743302-58743324 ACATGGCAGCAGAAAGAAGAAGG - Intronic
1097666631 12:62485111-62485133 ACACTGTAGCAGGAAGAACATGG - Intronic
1097738892 12:63215222-63215244 AAATAGTAGCAGAAATAATAAGG + Intergenic
1098661101 12:73094579-73094601 ACATAGTAGCAGAAAAGAGAAGG - Intergenic
1100902348 12:99256705-99256727 TCATTATAGCAGAATTAACAAGG - Intronic
1100945271 12:99776427-99776449 ACCTATTAGCTGAATGAACATGG - Intronic
1101521120 12:105483383-105483405 ACATGGAAGCAGAATGTGCAAGG + Intergenic
1103003983 12:117407268-117407290 ACAGAAAAGCAGAATGATCAGGG - Intronic
1104431817 12:128722655-128722677 ACACAGGAGCAGCATGAAAATGG - Intergenic
1105636215 13:22217995-22218017 ACACAGCAGCAGAATGCAGAGGG + Intergenic
1106338824 13:28809153-28809175 ACACAGTAGCAGGCTGCACAGGG - Intergenic
1107347435 13:39476983-39477005 AAATAGTAACAGATTGAAGATGG + Intronic
1107593835 13:41940065-41940087 ACATCGTAGCAGACTGTAAAAGG + Intronic
1110036399 13:70690797-70690819 ACTCAGTAGCAGAAGGAAGAGGG - Intergenic
1110212264 13:72987595-72987617 TCTTAGTAGCTAAATGAACATGG + Intronic
1110652091 13:77953494-77953516 ACCTACAACCAGAATGAACATGG + Intergenic
1110766818 13:79289518-79289540 ACATATTAGCATATTGCACAAGG - Intergenic
1112219139 13:97470400-97470422 AAATAATAGCTGAATGAGCATGG - Intergenic
1112683374 13:101793519-101793541 ACATAGTGCCACAATCAACATGG + Intronic
1114598481 14:23934503-23934525 AGAAAGTAGCAGAGTGAACATGG + Intergenic
1114810788 14:25896587-25896609 ACATAGTTCCAGAATGAGTAGGG - Intergenic
1115075191 14:29380657-29380679 CCATAGGTGCAGAATGAACTGGG - Intergenic
1115544204 14:34450223-34450245 AATTAGTAGCAGGATGAACTTGG - Intronic
1117047218 14:51825624-51825646 ACAGAGTACAAGAAGGAACAAGG - Intergenic
1120111350 14:80561034-80561056 ACTTAGAAGCAGAATGAACTTGG + Intronic
1120365058 14:83557335-83557357 ACATAGTTGGAAAAAGAACATGG - Intergenic
1120560351 14:85984572-85984594 ACATAGCAGTAGTATGAAAATGG + Intergenic
1120605700 14:86574586-86574608 ACATATGAGCATAATGAAGACGG + Intergenic
1121697426 14:95925174-95925196 ACATTGTAGAAGAAGGAAAAAGG + Intergenic
1126182470 15:45799008-45799030 ACTTAGTTTCAGAATGCACAAGG - Intergenic
1127675516 15:61234483-61234505 ATATAGTGGCAGAATCATCATGG - Intergenic
1127702375 15:61513856-61513878 ACAGAGTAGAATAATCAACATGG - Intergenic
1128372780 15:67052694-67052716 ACCTAGTGGCAGGATGAACACGG + Intergenic
1128814727 15:70599275-70599297 ACATGGAAGCAGAAAGATCAGGG - Intergenic
1128923561 15:71633760-71633782 TCAGAGTAGCAGAATGGATATGG + Intronic
1129529421 15:76251271-76251293 ACATATTAGCAAAATTAAAAAGG + Intronic
1129773372 15:78216997-78217019 ACAGAGTCCCAGAATGAACCAGG - Intronic
1130120603 15:81044292-81044314 TGATAGTGTCAGAATGAACATGG - Intronic
1130676976 15:85961459-85961481 ACACAGTAGCTGGATGAACTTGG + Intergenic
1130860266 15:87879762-87879784 ACATAGTAATAAAATAAACACGG + Intronic
1131783729 15:95888333-95888355 ACATTGTACCAGAAGGAAAATGG + Intergenic
1131887957 15:96939450-96939472 AGATAGTATCATAATGAATAGGG - Intergenic
1131898894 15:97066160-97066182 AAATAGGAGGAGAATGAAGAGGG - Intergenic
1138856074 16:60694443-60694465 ACATATTGGCAGAATGAATTAGG + Intergenic
1140117075 16:72051219-72051241 AAATAGTAGCAGATGTAACAAGG - Intronic
1147835174 17:43324881-43324903 AGATAGGAGCTGAAGGAACATGG - Intergenic
1148841869 17:50503968-50503990 ACAGAGTGGCAGGATGAACCGGG + Intergenic
1149624678 17:58072439-58072461 AAATACTAACAAAATGAACATGG + Intergenic
1150242591 17:63647218-63647240 ACATAGGAGCAGAAGGACCCTGG - Intronic
1153784178 18:8519705-8519727 ATTTAGTAGGAAAATGAACAAGG + Intergenic
1156022427 18:32615425-32615447 ACTTGGTAGCTGACTGAACATGG + Intergenic
1156157454 18:34320221-34320243 ACACTGTAGCAAAATGAACCTGG + Intergenic
1156157771 18:34323706-34323728 CCATAGTGGCAGAATGTCCATGG - Intergenic
1156342737 18:36225846-36225868 AAATAGTAGCAGCAAGAAAATGG - Intronic
1156421304 18:36956060-36956082 AGATAAGAGCAGAATGAATAAGG - Intronic
1157023959 18:43820497-43820519 ACAGTGTAGCAGAATGAAACTGG - Intergenic
1158041703 18:53102226-53102248 AAATAGTAGCACTATGAAAAAGG - Intronic
1158740706 18:60139111-60139133 ACATAGTAGGAAAAGGAAAATGG - Intergenic
1159289829 18:66402264-66402286 ATATAGGAGCGGAATGAAAATGG - Intergenic
1160469238 18:79113604-79113626 ACACAGGTGCAGAATGACCAAGG - Intronic
1167832168 19:52032951-52032973 ACATACTAGCAGCATTATCATGG - Exonic
926618123 2:15020048-15020070 AAATAGTAGCTGTATGAACTTGG - Intergenic
928829889 2:35468206-35468228 ACATAGTTGTTGAATGAAGAAGG + Intergenic
929706701 2:44220394-44220416 ACATAGTAGCTACATAAACAGGG + Intronic
931880729 2:66567813-66567835 TCATAGTAGCAGAAAGAGCTGGG - Intronic
932539054 2:72632136-72632158 ACAGAATAGAAGTATGAACATGG + Intronic
932688697 2:73894485-73894507 AAATGTTGGCAGAATGAACAAGG - Intronic
932969579 2:76524120-76524142 ACCTGGTAGCAGGAAGAACATGG + Intergenic
933334566 2:80940451-80940473 ACATAATGGCAAGATGAACATGG - Intergenic
933344976 2:81071855-81071877 ACCCAGTAGCAGAATGGAGAGGG + Intergenic
936748903 2:115616380-115616402 ACATAGTAGCGGCATAACCATGG - Intronic
936772441 2:115930787-115930809 ACTTATTAGCAGAATCAACATGG - Intergenic
937248414 2:120508951-120508973 ACAAAGCAGCAGAAGGAACCTGG + Intergenic
938936253 2:136130180-136130202 CAATAGTATCAGAATGAGCAGGG + Intergenic
939347247 2:140981460-140981482 ACACAGTAACAGAATGAGCCAGG - Intronic
939639345 2:144620438-144620460 CCATAGGAGGAGAATGGACAAGG + Intergenic
941389538 2:164894697-164894719 ACATGGGAGGAGAATTAACAAGG - Intergenic
942406671 2:175663263-175663285 ACATAGGAGGAGAAAGAAAAAGG + Intergenic
943803445 2:192091293-192091315 ACACAGTAGCAGAAACATCAGGG + Intronic
946661016 2:221999500-221999522 ACACAGTGGCACAATGACCAGGG - Intergenic
1169278881 20:4250560-4250582 TCATAGTTGCAGAATGAGGAGGG + Intergenic
1170264533 20:14450780-14450802 ACATAGTACCTGAAGGAAAAGGG + Intronic
1173005445 20:39136633-39136655 TCACAGTTGCAGAATGACCAGGG - Intergenic
1173322715 20:42002864-42002886 ACATAGTAACTGATAGAACAAGG - Intergenic
1175539480 20:59739348-59739370 ACTTTGTAGCAGTATGAAAACGG - Intronic
1177060772 21:16371689-16371711 ATATACTAGCTGAATGATCATGG + Intergenic
1178378463 21:32088588-32088610 ACTTACTAGCTGAGTGAACATGG - Intergenic
949656130 3:6222237-6222259 ACATAATAGCTAAATAAACAGGG - Intergenic
951059015 3:18182910-18182932 ACTGAATAGCAGAATCAACATGG - Intronic
953302548 3:41793384-41793406 ACATATGAGCAGAATCACCAAGG + Intronic
953706435 3:45234589-45234611 ACACAGTAGCAGAATCCCCATGG + Intergenic
955061864 3:55499534-55499556 AAATAGTATCAGAAAAAACATGG - Intergenic
955185001 3:56706622-56706644 ATATAGTATCAGAATGAAAATGG + Intergenic
959265370 3:104130912-104130934 AAATAGTAGCAAACTGAAAAAGG - Intergenic
961387290 3:126529899-126529921 ACAGAGGAGCAGACAGAACAGGG - Intronic
961388728 3:126539217-126539239 ACATAGTCACAGAATCCACAAGG - Intronic
961620307 3:128218814-128218836 AAAAAGTAGCACAATAAACATGG - Intronic
964540463 3:157773792-157773814 ACATATTGGTAGAATGAATACGG + Intergenic
964846546 3:161050122-161050144 AAACAGTATCAGAAGGAACAGGG - Intronic
965782877 3:172306252-172306274 ACATGATTGCAGGATGAACAAGG + Intronic
965922251 3:173931355-173931377 GCATAGTAGCATAAGGAACATGG + Intronic
966917513 3:184593196-184593218 ACAGAGTGGCAGGAGGAACAGGG - Intronic
967222492 3:187259205-187259227 GCAAATAAGCAGAATGAACAAGG - Intronic
968344420 3:197989099-197989121 ACACTGTAGCAGACAGAACAGGG - Intronic
969973064 4:11067916-11067938 ACACAGTAGCAGTATGAACTTGG - Intergenic
970221446 4:13816181-13816203 ACAAAGTAGCAGCAAGCACAAGG - Intergenic
970422156 4:15915409-15915431 ATCTAGTAGCAGAATGATCCAGG - Intergenic
972314422 4:37912711-37912733 ACATAGTAGAAGAAGGAAGCAGG - Intronic
974406412 4:61476746-61476768 ACATAGAAGAAGAATAGACAGGG + Intronic
974662516 4:64911465-64911487 ACCTAGTAGAAGAAGGAACTAGG - Intergenic
975597887 4:76067175-76067197 ACAAAGTAGCAGAATGAGTTGGG + Intronic
975899233 4:79130373-79130395 GCATAGTACCAGCATGAAGACGG - Intergenic
978946096 4:114498637-114498659 AAATAGTAGTAAAATAAACATGG - Intergenic
980563292 4:134504485-134504507 TAATAGGAGCAGAATGAACAAGG + Intergenic
981309100 4:143278718-143278740 ACTGATTAGTAGAATGAACATGG + Intergenic
981406029 4:144370424-144370446 ACATGGGAGCATAATAAACAGGG - Intergenic
982163908 4:152597388-152597410 ACAGGGTAGCTGAATGGACAGGG - Intergenic
983872771 4:172841408-172841430 AAATAGTAGCTGCATGAACTTGG - Intronic
983974225 4:173913147-173913169 ACATAGTAGGACAATGGAGAAGG + Intergenic
984595616 4:181664096-181664118 ACATACTAGCTGAATGATCCAGG + Intergenic
987670799 5:21005254-21005276 ATATGGTAGTACAATGAACATGG + Intergenic
988154724 5:27436173-27436195 GCATATGAGCAGAATGAACCTGG - Intergenic
988841655 5:35089573-35089595 AAAAAGTAGCAGAGTGAAAACGG + Exonic
989376171 5:40763816-40763838 ACATAGTAGCAGAAAGACACAGG - Intronic
989692698 5:44163761-44163783 ACATATTAACAAAATGAAAATGG - Intergenic
989736884 5:44718285-44718307 ACTTACTAGCAGAATGAATGTGG - Intergenic
991090417 5:62689022-62689044 AGATAGTAGAAGACTGAAGAGGG + Intergenic
991226046 5:64273497-64273519 ACATACTTGAAGAATGAGCAAGG + Intronic
991262441 5:64681488-64681510 ACATAGAAGCAGTATGCACTTGG + Intergenic
992219409 5:74557092-74557114 ACATAATAGCAGCATTGACATGG + Intergenic
992469138 5:77038434-77038456 AAATATTAGCACAATGAAAATGG - Intronic
992638124 5:78745132-78745154 GCATCGAAGCAGAATGAATATGG + Intronic
992917634 5:81474958-81474980 ACATAGCAGCAGGATGAAAATGG + Intronic
993138115 5:83996370-83996392 ACTGAGCAGCAGAAGGAACAAGG + Intronic
994127035 5:96179560-96179582 ACATTGTAGATGAATGAATATGG + Intergenic
995140149 5:108727263-108727285 ACATAGTAGGACAATGAAACTGG - Intergenic
996864012 5:128098213-128098235 ACTTAATAGCAGAATGGAAATGG - Intronic
998743751 5:145233165-145233187 ACATTCTAGCAGTATGATCATGG - Intergenic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1002857232 6:1048708-1048730 ACAGTGTAGCAGAAAGAACCAGG + Intergenic
1002869483 6:1153985-1154007 ACATAGTATCACAATTAACAGGG - Intergenic
1008140867 6:47830622-47830644 AATAAGTAGCAGAATGAACCAGG + Intronic
1008658193 6:53637757-53637779 GAATAGTGGCACAATGAACATGG + Intergenic
1009383777 6:63064359-63064381 GCAAAGTAGCAGAATCATCATGG - Intergenic
1012803581 6:103867516-103867538 ACATAGTATCTCTATGAACAAGG + Intergenic
1014370016 6:120594290-120594312 ACATAGTAGCACGAAGAAAATGG + Intergenic
1014630783 6:123787225-123787247 ACATAGTGGGAGCAGGAACAAGG + Intergenic
1014695485 6:124615857-124615879 ACACAATAGCAGATTGAAGATGG - Intronic
1014834793 6:126148546-126148568 ACATATTAGCTGAATGATCTGGG + Intergenic
1015162266 6:130166607-130166629 ACATAATAGAAGAAAGAATAAGG + Intronic
1015509302 6:134022153-134022175 ATATAGAAGCAGAAAGAACATGG + Intronic
1015743489 6:136484434-136484456 ACATCATACCAGAATGACCATGG - Intronic
1016103667 6:140134684-140134706 ACCTAGTATCATACTGAACAGGG + Intergenic
1017296317 6:152799149-152799171 ACATAGTGGCATTATGAACTAGG - Intergenic
1018555220 6:165042535-165042557 ACAAAGCAGCAGAATGTCCAGGG + Intergenic
1018965303 6:168481308-168481330 ACATAGTAGCAGAATGAACAGGG + Intronic
1018965381 6:168482774-168482796 TCATAGTAACAGAATGAATAGGG + Intronic
1020632170 7:10652538-10652560 ACATAGTAGACGTGTGAACAAGG + Intergenic
1020674803 7:11169889-11169911 ACATAGTTCAAAAATGAACAGGG + Intergenic
1022223836 7:28342541-28342563 TCATAGTTGCAGAATTAAAATGG + Intronic
1026286636 7:68969181-68969203 ACATAGTCCCAGAAAGATCAGGG - Intergenic
1027433355 7:78136863-78136885 TCACAATAGAAGAATGAACAAGG - Intronic
1028309003 7:89305884-89305906 ACAAAGTATCAGAATAAAAATGG - Intronic
1030523623 7:110628212-110628234 ACATTTTAGCAGAGTAAACATGG - Intergenic
1031939490 7:127772801-127772823 CCTTGGTAGCAGAATGAACCAGG + Intronic
1032139267 7:129311960-129311982 AGAGTGTAGCAGAATGAACAAGG - Intronic
1032592268 7:133202707-133202729 CCATAGATGCAGAAGGAACAGGG + Intergenic
1032975890 7:137221798-137221820 ACATGGAAGCAGAATGTAGATGG + Intergenic
1033790230 7:144783959-144783981 ACATAGAGACAGAAAGAACAAGG + Intronic
1035882588 8:3258129-3258151 ACAGAATATGAGAATGAACAGGG + Intronic
1036062385 8:5338334-5338356 ACTTAATAGCAAAATGGACATGG + Intergenic
1038958585 8:32493950-32493972 AAATGGTAGCATAATGAAAAAGG + Intronic
1039908602 8:41806351-41806373 ACACAGTAGTGGAAAGAACAGGG - Intronic
1044123047 8:88421966-88421988 ACATAATAGGAAAATAAACAGGG - Intergenic
1046509194 8:115178027-115178049 TTTTAGTAGCAGACTGAACATGG + Intergenic
1047467611 8:125133057-125133079 AGATAGAAGCAGAATGAAAGTGG - Intronic
1047990014 8:130276297-130276319 TCACAGTAGCAGAATGTATATGG - Intronic
1049839716 8:144763167-144763189 ACATACTTGCTGAATGGACAAGG - Intergenic
1050876422 9:10643122-10643144 ACATATTAGCAAAATGACCTTGG - Intergenic
1051004755 9:12329630-12329652 AGATAGGAGCTGAAGGAACACGG - Intergenic
1051217879 9:14818027-14818049 ATATACTAGCTGAATGAACTTGG + Intronic
1051893104 9:21963332-21963354 ACATAATAGGAGAATGAAACTGG - Intronic
1051975712 9:22945945-22945967 ACAAGGGAGCAGAATGAAGAAGG - Intergenic
1052097320 9:24398854-24398876 AAATGGTAGCAGAATGTCCATGG + Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1059839511 9:118196987-118197009 ACATAGTATCATACCGAACAGGG + Intergenic
1060671338 9:125472282-125472304 GCAGAGCAGCAGAAAGAACAGGG - Intronic
1185954057 X:4469747-4469769 AGAAAGTAGCAGAAAGTACAAGG - Intergenic
1186306415 X:8264562-8264584 CCAGAGAAACAGAATGAACAGGG - Intergenic
1186535550 X:10343625-10343647 ACAGACAAGCAGAAAGAACATGG + Intergenic
1186799862 X:13082158-13082180 TCATAGTAGCAGAATGTATCAGG + Intergenic
1187000074 X:15167626-15167648 ACATAGAATAAGAAGGAACATGG - Intergenic
1187724899 X:22192287-22192309 AGATAGTAGTGGTATGAACAAGG - Intronic
1190888439 X:54549182-54549204 ACATGGAAGCAGACTGGACAAGG + Intronic
1192104556 X:68301720-68301742 ACATAGTGGCAGAATGGACGGGG - Intronic
1193210233 X:78798778-78798800 ACATACTAGCTGCATGAACATGG - Intergenic
1195134741 X:101893811-101893833 ACAAAGTGGCAGCATGAACGAGG + Intronic
1195527146 X:105903882-105903904 ACATAGTAAAAGAATAAAAAGGG + Intronic
1196862806 X:120043515-120043537 AAATAATAGTAGACTGAACATGG + Intergenic
1196880296 X:120192829-120192851 AAATAATAGTAGACTGAACATGG - Intergenic
1197517089 X:127446329-127446351 ACACAGCAGCAGAAGCAACATGG + Intergenic
1198473485 X:136972697-136972719 ACTTACTAGCTGAATGACCATGG - Intergenic
1199323226 X:146465942-146465964 ATATAGTACCATACTGAACAAGG + Intergenic
1199778384 X:151035770-151035792 ACATAGTAGTAGAATGACTTTGG - Intergenic