ID: 1018967459

View in Genome Browser
Species Human (GRCh38)
Location 6:168499777-168499799
Sequence TAGGGGACTGTGGAGCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018967452_1018967459 18 Left 1018967452 6:168499736-168499758 CCGTGAGGAGCTACACATTTCAT 0: 1
1: 0
2: 2
3: 11
4: 137
Right 1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG 0: 1
1: 1
2: 2
3: 17
4: 224
1018967451_1018967459 19 Left 1018967451 6:168499735-168499757 CCCGTGAGGAGCTACACATTTCA 0: 1
1: 0
2: 1
3: 13
4: 115
Right 1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG 0: 1
1: 1
2: 2
3: 17
4: 224
1018967450_1018967459 29 Left 1018967450 6:168499725-168499747 CCACTGGGAGCCCGTGAGGAGCT 0: 1
1: 0
2: 1
3: 22
4: 196
Right 1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG 0: 1
1: 1
2: 2
3: 17
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018967459 Original CRISPR TAGGGGACTGTGGAGCAGAT TGG Intronic
900369201 1:2323947-2323969 TGGGGGACTGGGGAGCAGCCAGG - Intronic
900649526 1:3724042-3724064 CAGGGGACTGGGGGGCATATAGG + Intronic
901029592 1:6299208-6299230 AAGGTGACTGAGGAGCAAATGGG + Intronic
902879205 1:19359895-19359917 ATGGGGACTTTGGAGCAGACCGG - Intronic
903653320 1:24933944-24933966 TAGGGCACTGGGCAGGAGATAGG - Intronic
903778376 1:25807370-25807392 AAGGAGACAGTGCAGCAGATAGG + Intronic
904173838 1:28611240-28611262 TTGGGGAATGTGAAGCAGAATGG + Intronic
904311512 1:29632588-29632610 TAGGGGACTGAGGAGATGAGGGG - Intergenic
904411492 1:30327705-30327727 TTTGGGACTGTGGAGGACATAGG + Intergenic
904850115 1:33452820-33452842 TGGGGGGCTGTGGAGGAGGTTGG + Intergenic
908598651 1:65715133-65715155 TAGGGGATTGTGGGGGAGGTGGG + Intergenic
910326489 1:86013960-86013982 AAGGGGACTGTGCAGGAGAAAGG - Intronic
910799232 1:91129053-91129075 TAGGAGGCTGGGGAGCAGAAGGG - Intergenic
913099711 1:115551862-115551884 TTGCTGACTGTGGAGCAGAGAGG - Intergenic
915521768 1:156449539-156449561 TAGAGGAAAGTGGAGAAGATTGG + Intergenic
919621743 1:199871420-199871442 GAGGGAACTGGGGAGGAGATAGG - Intergenic
922198231 1:223378225-223378247 CAGGGGGCTGTGGAGCATAGTGG + Intergenic
923564287 1:235065079-235065101 TGGTAGACTGTGGAGTAGATGGG + Intergenic
924709162 1:246519641-246519663 TAGGGGAATGGGGAGAAGAAGGG + Intergenic
1063282469 10:4645357-4645379 AAGGGCAATGTGGAGAAGATAGG - Intergenic
1063360609 10:5453519-5453541 GATGGAACAGTGGAGCAGATTGG + Exonic
1066512447 10:36116820-36116842 TAGGGGGCTGTAGAGCAAATTGG - Intergenic
1067566644 10:47343751-47343773 GAGGGGACTGGGGAGCAAAGGGG + Intergenic
1067582138 10:47452583-47452605 TAGGGCACTGCAGAGCTGATAGG - Intergenic
1069960356 10:72075637-72075659 TGGGGGATGGTGGAGCAGCTGGG - Intronic
1070301627 10:75208260-75208282 TAGGGTGCTGTGGTGCAGTTGGG + Intergenic
1070393803 10:75994011-75994033 TTGGGGCCTGTGGAGCAGGCAGG - Intronic
1071234269 10:83626236-83626258 TAGGGGACTGAGAAGCAATTTGG + Intergenic
1071481578 10:86068978-86069000 TAGGGGCCTGTGGAGCAGATTGG - Intronic
1072040598 10:91602566-91602588 TAAGGGACTGTAGGGCAGACTGG - Intergenic
1076010563 10:126984942-126984964 TAGGGGAGTGGGGAGATGATGGG - Intronic
1077615536 11:3671100-3671122 TTGGGGAGTGTGGAGGAGAGGGG - Intronic
1077970535 11:7184381-7184403 TGGGGGACTGTGGGGGAGGTGGG + Intergenic
1078259312 11:9689858-9689880 TTGGGCCCTGTGGAGCTGATGGG + Intronic
1078958902 11:16239794-16239816 GAGGGGAGTGTGGAGCAAAAGGG - Intronic
1080194240 11:29589445-29589467 TAGGGCACTGTGGTGAAAATTGG - Intergenic
1082822226 11:57551949-57551971 CTGGGGACAGTGGAGCATATGGG - Exonic
1085702316 11:78756168-78756190 CAGGGTACTGTGGAGCACAGAGG - Intronic
1088402720 11:109438908-109438930 TAGGAGACTGAGGAGTAGAGAGG - Intergenic
1089398300 11:118149982-118150004 AAGGAGACTGTGGAGAAGAGAGG - Intronic
1090186894 11:124745194-124745216 TAGGGGTCTGCAGAGCTGATTGG - Intronic
1091818164 12:3455034-3455056 AAGGGGACTGTGGAGGACAAGGG - Intronic
1092264106 12:6968061-6968083 GAGGGGACTGGGGAGCTGAAAGG + Intronic
1092396194 12:8128911-8128933 CCTGGGACTTTGGAGCAGATGGG - Intronic
1093860998 12:24167405-24167427 TAGTGGCCTGTGGAGCAGGTTGG + Intergenic
1095550676 12:43435247-43435269 TAGAGGAGTGTGGAGGAGAATGG + Intronic
1095849716 12:46789084-46789106 TAGGGAACTGTGGCTCAGAAAGG + Intronic
1096078662 12:48819620-48819642 CAGGGGGCTGTGGAATAGATGGG - Intronic
1097022759 12:56032545-56032567 GAGGAGACTGTGGAGGAGAGTGG - Exonic
1097688887 12:62715541-62715563 ACGGAGACTGTGGAGCAGCTTGG - Intronic
1098079655 12:66770616-66770638 CAGGGGACTGAGGACCACATGGG + Intronic
1098531390 12:71545882-71545904 TCAGGGAGTATGGAGCAGATTGG + Intronic
1100103204 12:91135318-91135340 TGGGGGACTGGGGAACAGGTAGG - Intergenic
1101030622 12:100654646-100654668 GAGGGTACAGTGGAGCAGGTAGG - Intergenic
1101643853 12:106609576-106609598 TAGGGGATTGTGGAGCAGGTGGG - Intronic
1104782597 12:131431421-131431443 GTGGGGACTGTGGCGCAGAGAGG - Intergenic
1105706550 13:22971053-22971075 TGGGGCCCTGTGGAGCTGATGGG - Intergenic
1106097215 13:26658800-26658822 TAGGGCATTGTGGAGCACAGAGG + Intronic
1106739474 13:32624124-32624146 AAGGGGAGTGTTGACCAGATTGG - Intronic
1108319245 13:49271656-49271678 AAGAGGACTGTGGAGCACCTTGG + Intronic
1109211398 13:59539232-59539254 TAGGAGACGGTGGAGCATAATGG - Intergenic
1114182430 14:20377916-20377938 GAGGAGACTGTGGAGGAGCTTGG - Intronic
1114532859 14:23406210-23406232 ATGGGGAGTGTGGAGTAGATGGG - Intronic
1114591771 14:23872083-23872105 TAGGGGAGAGAGGAGCAAATAGG + Intergenic
1119402365 14:74371938-74371960 TTGGAGACTGTGGGGCAGAGAGG - Intergenic
1121007724 14:90500953-90500975 TGGGGGACTGGGGAGGAGAGAGG + Intergenic
1121448548 14:93993609-93993631 TTTGGGGCTGTAGAGCAGATGGG + Intergenic
1122006482 14:98708499-98708521 TCGGGGGCTGGGGAGGAGATGGG - Intergenic
1122207340 14:100154527-100154549 TAGGGGCCTATGGAGAAGAAGGG + Intronic
1126778436 15:52119033-52119055 AAGGGGAATGGGGAGGAGATGGG + Exonic
1128931598 15:71709423-71709445 AAGTGGACTGTGGAGAAGAAGGG + Intronic
1129664696 15:77573030-77573052 AAGGAGACTGTGGAGCAGAGCGG - Intergenic
1129754821 15:78091708-78091730 GAGGGGACTTTGGAGTAGATGGG - Intronic
1129939539 15:79482252-79482274 TAAGGTACTGTGGAGCAGCGTGG - Intergenic
1130545802 15:84857157-84857179 GAGGGGAGTGTGGAGCAGGTGGG + Exonic
1131931127 15:97443099-97443121 TAGGGGACTCAGAAACAGATGGG - Intergenic
1131950006 15:97671987-97672009 TAGGGGACTGTGGCAGAGGTAGG - Intergenic
1132543696 16:523356-523378 TGGGGGACTCTTGATCAGATGGG - Intergenic
1133059698 16:3166453-3166475 CGGGGGATTGTGGAGCAGGTGGG - Intergenic
1133783296 16:8955829-8955851 TAAGGGGCTGTGGAGTAGAAAGG + Intronic
1135564308 16:23499944-23499966 GAGGGGACTCTGGGCCAGATTGG + Intronic
1135643118 16:24138188-24138210 AAGGGGACTATGGAGCTGAGTGG - Intronic
1136188618 16:28602270-28602292 TAGGGGAGTGTGGAGGACAGGGG - Intergenic
1136191088 16:28615264-28615286 TAGGGGAGTGTGGAGGACAGGGG - Intronic
1138076736 16:54050061-54050083 TGGGGGCCTGTGGGGCAGACAGG + Intronic
1138290954 16:55846508-55846530 AAGAGGACTGTGGAGCATGTCGG + Exonic
1141735532 16:85849886-85849908 TGTGGGACTGAGGAGCAGAGAGG - Intergenic
1142198761 16:88751142-88751164 TTGGGGACTGAGGGGCAGGTGGG - Intronic
1142614164 17:1125313-1125335 GAGGGGAATGAGGAGCAGAAGGG - Exonic
1144476914 17:15596462-15596484 AAGGGCACTGGGGAGGAGATGGG - Intronic
1144921327 17:18766892-18766914 AAGGGCACTGGGGAGGAGATGGG + Intronic
1144992307 17:19241894-19241916 CAGGGGCCAGTGGAGCAGAAGGG - Intronic
1145812688 17:27774023-27774045 TAGTGGCCTGTGGCTCAGATGGG - Intronic
1147017865 17:37506852-37506874 TAGGGGAAACTGGAGCAGCTCGG + Intronic
1147166594 17:38596677-38596699 TAGTGGGGAGTGGAGCAGATGGG - Intronic
1147579341 17:41619523-41619545 CCGGAGACTGTGGGGCAGATGGG + Exonic
1148744691 17:49911742-49911764 GAGGGGACTGAGGAGCAGCCTGG + Intergenic
1149500544 17:57149188-57149210 GAGGGTAATGTGGAGGAGATGGG - Intergenic
1151221663 17:72617162-72617184 TGGGGGGCTGTGGAGGAGTTGGG + Intergenic
1151293698 17:73168029-73168051 TAGGCCACTGAGGAGCAGAGGGG + Intronic
1151518459 17:74612441-74612463 CAGGGGACTGGGGAGGAGAAAGG + Exonic
1152148520 17:78584232-78584254 TAGGCGAGTGTGGTGGAGATTGG - Intergenic
1152477579 17:80528188-80528210 TTTGGGCCTGTGGAGCAGAGTGG - Intergenic
1152933743 17:83124226-83124248 TGGGAGACTGTGGACCAGGTGGG + Intergenic
1153326846 18:3829510-3829532 TAGGGGACTGTGGATCAGTCAGG + Intronic
1154424954 18:14264993-14265015 TGGGGGATTGTGGTGCAGTTGGG + Intergenic
1155707730 18:28837554-28837576 TGGGGGACTGTTGAGAAGAAAGG - Intergenic
1156743834 18:40365588-40365610 GTGGGGAATGAGGAGCAGATGGG - Intergenic
1157217021 18:45792708-45792730 AAGCGGGCTGTGGAGGAGATTGG - Intergenic
1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG + Intergenic
1162870655 19:13584015-13584037 AAGGAGACTGTGGAGCTTATTGG - Intronic
1163143970 19:15368584-15368606 CAGGGGGCTGTGGTGCACATGGG - Intronic
1164011847 19:21210507-21210529 CAGGGGAATGAGGAGCAGCTGGG - Intergenic
1166930357 19:46298211-46298233 TAGGGGACAGGGGAGAGGATGGG - Intronic
1167533761 19:50035880-50035902 CTGGGGATTGTGTAGCAGATGGG + Intronic
926384535 2:12323360-12323382 GAGTGGACTGAGGAGCAGAGTGG + Intergenic
927951959 2:27176842-27176864 TAGTGGAAACTGGAGCAGATGGG + Intergenic
928560913 2:32484192-32484214 TTGGGGGCTGGGGAGCAGAATGG + Intronic
928622810 2:33108222-33108244 TGGGGGGCTGTGGGGCAGAGGGG + Intronic
928749678 2:34457324-34457346 AAGGGGACTGTCTTGCAGATTGG - Intergenic
933572913 2:84034889-84034911 TAAGGCACTGTGGAGAAAATGGG + Intergenic
934960698 2:98669778-98669800 TTGGGGACTGTGGGGCAAAGGGG + Intronic
935361953 2:102252853-102252875 TGAGGCAGTGTGGAGCAGATGGG + Intergenic
935575971 2:104710873-104710895 TAGGGGATTGTGGGGGAGTTGGG - Intergenic
939101399 2:137898484-137898506 TGGTGAACTGTTGAGCAGATTGG - Intergenic
939591106 2:144064933-144064955 TAAGGGACTGAGGAGGAGAGGGG + Intronic
939637091 2:144595270-144595292 AAGGGGACTGGTGAACAGATGGG + Intergenic
942253694 2:174070480-174070502 CAGGGGACAGTGGAGCAGCATGG - Intergenic
945632576 2:212300229-212300251 CAGGGGACTGTTCAGCAGAAGGG - Intronic
945936577 2:215908247-215908269 CAAGGGAGTGAGGAGCAGATTGG - Intergenic
946311838 2:218886461-218886483 TAGGGGAGGGTGGAGGAGAGAGG - Intronic
946436956 2:219663534-219663556 AAGGGGACTGTGGCACAGAGAGG + Intergenic
947691570 2:232141685-232141707 TAGAGGACTGTGGTAGAGATGGG + Intronic
1168973339 20:1945950-1945972 AAGGGCACTGTGGAGTTGATGGG - Intergenic
1172242519 20:33422934-33422956 TAGGGGACTGCGGAGGTGATGGG - Intronic
1174358732 20:50015133-50015155 TAGGGCAATGGGAAGCAGATGGG + Intergenic
1174566634 20:51469438-51469460 TTGGGAACTGAGGAGCAGACAGG + Intronic
1174970238 20:55267131-55267153 TAGGGAACTCTGGAGCATAATGG + Intergenic
1176257147 20:64158535-64158557 CAGGGGCCAGTGGAGCAGGTGGG - Intronic
1177018759 21:15825697-15825719 TAGGGGAATGCAGAGCAGATTGG - Intronic
1178105755 21:29317502-29317524 TTGGGGCCTGTGGAGCAGGAAGG + Intronic
1178891664 21:36525279-36525301 TAGGGGACTCTGGGGCAGGAGGG + Intronic
1178893095 21:36536275-36536297 TAGGGGACTGAGGACAAGAGTGG + Intronic
1179997327 21:44980094-44980116 TGGGGGACTGTGGGGCACAATGG + Intergenic
1180991731 22:19941329-19941351 TAGGGGTCTGGGGAGAAGTTGGG + Intronic
1181039258 22:20184245-20184267 TAGGGGACTGTGGGGTGCATCGG - Intergenic
1181039336 22:20184473-20184495 TAGGGGACTGTGGGGTACATGGG - Intergenic
1182007377 22:26972063-26972085 CAGGGGACAGGGGAGCAGGTTGG + Intergenic
1182115083 22:27751839-27751861 TTGGGGATTGGGGAGCACATGGG - Intronic
950378516 3:12591618-12591640 TAGTGGACTGTGCCGCAGGTTGG - Intronic
950566224 3:13771226-13771248 TAGGGGACTGCGGAGCAGCTAGG - Intergenic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
953552125 3:43911224-43911246 CGAGGGACTGTGGAGCAGAGGGG + Intergenic
955346511 3:58165640-58165662 TAGGGGAATGTGGAGAATTTGGG + Intronic
955949192 3:64225104-64225126 TGAGGGAATGTGGAGCAGCTCGG - Exonic
955977173 3:64490185-64490207 TAGGGGACCTGGCAGCAGATGGG - Intergenic
956171991 3:66440222-66440244 TAGTGGGCTGGGGAGCAGAGGGG - Intronic
959002688 3:100982748-100982770 TAGGGGAGTTTGGAGAGGATGGG + Intronic
960300999 3:116002484-116002506 TAGGGGTATGTGGTGCAGCTGGG - Intronic
960952932 3:123011399-123011421 TAGGAGACTGTGGGGCAGCCGGG + Intronic
960993075 3:123324327-123324349 TTGGGCTCTGTGGAGCAGACTGG - Intronic
966235556 3:177697911-177697933 TCGGGGACTGTGGGGCAGGTGGG + Intergenic
969240643 4:5894734-5894756 AAGGGGTCTGTGCAGCAGGTAGG + Intergenic
969363761 4:6681919-6681941 TTGGGGGCTGTGGGGCAGCTGGG + Intergenic
970745235 4:19286323-19286345 AAGGGGACTGTGGAGCCATTGGG + Intergenic
974026735 4:56739431-56739453 TGGGGTAATGGGGAGCAGATGGG - Intergenic
974693291 4:65330311-65330333 TTGGGGATAGAGGAGCAGATAGG + Intronic
974775595 4:66476596-66476618 TACCTGAGTGTGGAGCAGATGGG - Intergenic
977070155 4:92375137-92375159 CATGGGACTGTGGACCAGAAAGG + Intronic
979203679 4:118009082-118009104 AAGGGGACTGTGTTGCAGGTGGG - Intergenic
981073009 4:140564918-140564940 TAGGGGACTGAGGAAGAAATGGG - Intronic
981084676 4:140670876-140670898 TAAGGGACTGGGGAGCACACTGG + Exonic
982063333 4:151626342-151626364 TATAGGAGTGTGGAGAAGATGGG + Intronic
983642779 4:169958601-169958623 AAAAGAACTGTGGAGCAGATAGG + Intergenic
984749436 4:183257459-183257481 AAAGGGGATGTGGAGCAGATGGG + Intronic
988991179 5:36672408-36672430 TGGGGGAATGCTGAGCAGATGGG - Intronic
994854284 5:105097319-105097341 TAGGGGGCTGTTGGGGAGATTGG + Intergenic
996691098 5:126340920-126340942 TAAGGGTCTGTAGGGCAGATAGG - Intergenic
997615532 5:135243772-135243794 TTGGGGAATTTGGAGCAGAAGGG + Intronic
998218513 5:140255902-140255924 GAGAGGTCTGAGGAGCAGATAGG - Intronic
998806410 5:145921418-145921440 GAGGGGAGGGTGGAGCAGACTGG - Intergenic
999125794 5:149244946-149244968 TAGGGGTCTGGCGAGTAGATGGG - Exonic
999516809 5:152310118-152310140 TAGGAGACTGAGGATCAGTTGGG - Intergenic
1000668628 5:164031207-164031229 GAGGGGATAGTGGAGAAGATAGG + Intergenic
1001701660 5:173711245-173711267 TGGGGGAGTGTGGTGCAGATGGG - Intergenic
1002295058 5:178225897-178225919 CAGGGGGCTGTGGGGCAGCTTGG - Intronic
1004244845 6:13964627-13964649 GTGGGGAGTGGGGAGCAGATGGG + Intronic
1004920326 6:20370052-20370074 TGGGGGACTGTGGAGTATTTAGG - Intergenic
1006432379 6:34005520-34005542 TAGGGGACTCTGAAGCTGTTGGG - Intergenic
1006905496 6:37530543-37530565 TAGGGTACTGTGGACAAGTTGGG + Intergenic
1008951685 6:57167648-57167670 TGAGAGACTGTGGACCAGATGGG + Intronic
1012210320 6:96510597-96510619 TAGGGGACTGTTGAGAAGGGAGG + Intergenic
1014027210 6:116662713-116662735 TAGGGGGCTGTAGAGAAAATGGG - Intronic
1016529803 6:145044946-145044968 TAGGGGTCTGGGGAGCATATTGG - Intergenic
1017908196 6:158771151-158771173 CAGGTGACTGTGGAGCTGATGGG - Intronic
1018967459 6:168499777-168499799 TAGGGGACTGTGGAGCAGATTGG + Intronic
1019663132 7:2236824-2236846 GAGGGGACTGTTGGGGAGATGGG + Intronic
1019893024 7:3962305-3962327 TAGGGCACTGCAGAGCAGAGAGG + Intronic
1020017395 7:4838879-4838901 CAGGGGACTGAGGAGCAGAGTGG - Intronic
1020418235 7:7969537-7969559 TAGGGCACCGTGGCGCGGATGGG - Exonic
1024232290 7:47371768-47371790 TAGGTGACTGTGAAGTAGAGTGG + Intronic
1025036300 7:55594341-55594363 TAGGGTACTGTGCAGGAAATGGG + Intergenic
1027466591 7:78522942-78522964 TAGTGGACTGTTGAGCATCTTGG - Intronic
1030299901 7:107964524-107964546 TAGGGGAGTGTGTGGCAGGTCGG - Intronic
1030369996 7:108688320-108688342 TAGAGGGCTGGGGAGCAGGTGGG - Intergenic
1033130784 7:138743917-138743939 CAGGGGACTCTGGAGGAGAGGGG - Intronic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033628170 7:143131392-143131414 TTGGGGATTGTGGGGCAGCTGGG + Intergenic
1035667503 8:1389738-1389760 TAGGTGGCCGTGGAGCAGCTGGG + Intergenic
1037828310 8:22173319-22173341 TTGGGGAGTGTGGGGCAGATAGG - Intronic
1038308096 8:26422537-26422559 TAGGGGACTGGGAAGGAGACGGG + Intronic
1039387860 8:37152388-37152410 TAGGGGCCTGGAGATCAGATTGG + Intergenic
1039418762 8:37418419-37418441 TAGGGCACTGTGGTGAATATGGG + Intergenic
1039741684 8:40388693-40388715 TTGAGGACAGTGGAGCAGAAAGG - Intergenic
1040599633 8:48870772-48870794 TGGGGGACTGTGAGGCAAATAGG - Intergenic
1041521999 8:58767325-58767347 TAGGGGACAGTGGAGCCAAATGG - Intergenic
1041862693 8:62532335-62532357 TAGGGGACTGGGCAGGGGATAGG - Intronic
1043379907 8:79691530-79691552 TAGGGAATTGTGCAGCTGATGGG + Intergenic
1043987746 8:86714498-86714520 ATGGGGATTGTGGAGAAGATGGG + Intronic
1045833761 8:106495724-106495746 AAGGGGATTGTGGTGCAGAAAGG - Intronic
1047725237 8:127678787-127678809 TTGGGGACAGTGGGGTAGATGGG - Intergenic
1048833053 8:138495352-138495374 TAGAGGAAAGTGGACCAGATTGG - Intronic
1049182439 8:141229823-141229845 TGCGGGACTTTGGAGCAGCTTGG + Intronic
1049743389 8:144251808-144251830 TAGGGGACTGAGGGGCACACAGG - Intronic
1050270479 9:3939162-3939184 GAGGTGACTGTGGAACAGAGTGG - Intronic
1051893310 9:21965216-21965238 ACGGGGGCTGTGGAGCAGAAGGG - Intronic
1053540146 9:38965262-38965284 TAGGGCAGTGTGGAGAAGAGGGG - Intergenic
1053564629 9:39235982-39236004 TGGGGGGCTGGGGAGGAGATGGG + Intronic
1054132523 9:61383052-61383074 TGGGGGGCTGGGGAGGAGATGGG - Intergenic
1055492079 9:76815547-76815569 TAGGGGACTAGGGAGGTGATTGG - Intronic
1057695335 9:97318898-97318920 GAGGGCACTGGGGAGCAGAGTGG + Intronic
1057822308 9:98342160-98342182 CAGGGGCCTGTGGACCACATGGG - Intronic
1059791311 9:117644267-117644289 TTGGGCACTGTGCAGCATATAGG - Intergenic
1060026031 9:120172215-120172237 TTGAGGACGGTGGAGCATATTGG + Intergenic
1060591112 9:124817510-124817532 TGGGGTAGTGGGGAGCAGATGGG - Intergenic
1061322419 9:129839587-129839609 GAGGGGACTGTGGAGGGGGTGGG + Intronic
1061371796 9:130201578-130201600 TTGTGGAATGTGGAGCAGACAGG + Intronic
1062021318 9:134320716-134320738 TTGGGGACTGGGGTGGAGATGGG + Intronic
1192214936 X:69151474-69151496 CATGGGACTGTGAACCAGATTGG - Intergenic
1193656987 X:84210642-84210664 GAAGGGACTGTGGGGCAGAGGGG - Intergenic
1195435246 X:104836272-104836294 TGGGGGGCTGTGGAGGAGATGGG + Intronic
1196286531 X:113887704-113887726 TGGGGGACTGTGGAGAAGGTGGG - Intergenic
1198191034 X:134306145-134306167 TAGGGGACTGGCAAGGAGATGGG + Intergenic
1198531311 X:137551296-137551318 TTGGGGTGTGTGGAGCAGAGAGG - Intergenic
1199867413 X:151864700-151864722 TAGGGGGCTGGGGAGAAGGTAGG - Intergenic