ID: 1018967469

View in Genome Browser
Species Human (GRCh38)
Location 6:168499819-168499841
Sequence CTCCTTCCTGATTGCACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018967469_1018967471 24 Left 1018967469 6:168499819-168499841 CCAGCAGTGCAATCAGGAAGGAG 0: 1
1: 0
2: 0
3: 11
4: 201
Right 1018967471 6:168499866-168499888 CATGTTCTTCTCCGCACAATTGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018967469 Original CRISPR CTCCTTCCTGATTGCACTGC TGG (reversed) Intronic
900214704 1:1475292-1475314 CTCCTTCCTGGCCTCACTGCTGG + Intronic
900221916 1:1513642-1513664 CTCCTTCCTGGCCTCACTGCTGG + Intronic
900289398 1:1917504-1917526 GCCCTTCCTGCTTGCACTGGGGG + Intergenic
900352163 1:2240290-2240312 CTCCTCCCTGACTTCTCTGCCGG - Intronic
906521153 1:46467610-46467632 CTCCTCCCTGATAGCACCTCAGG - Intergenic
908120454 1:60981391-60981413 CTTTTTCCTGGTTGCACTTCTGG + Intronic
909586138 1:77290874-77290896 CTACTGCTTGATTTCACTGCTGG - Intronic
910039746 1:82835365-82835387 CTCCTTCCTAACTGCTCTGTGGG - Intergenic
910366746 1:86473825-86473847 CTCACTCCTGATTTCATTGCAGG + Exonic
915774849 1:158471830-158471852 CTCCTTGCTGCTGTCACTGCTGG + Intergenic
916168938 1:161986338-161986360 CTCCTTCCTCAAACCACTGCGGG - Intronic
917626689 1:176853661-176853683 CTCCTTCCTCATTGGCCTCCTGG + Intergenic
918061863 1:181068651-181068673 CTGCATCCTGATTGCAGTGGTGG + Intergenic
919621356 1:199867639-199867661 CTGCTTCTTGAGAGCACTGCAGG - Intergenic
920209879 1:204320364-204320386 CTCCTTCCTCAGGGCCCTGCTGG - Intronic
922490761 1:226014603-226014625 TTCCTTCCTGTGTGCTCTGCTGG + Intergenic
1065463807 10:25997990-25998012 CTCCTTCCCTTTTGCACTGTAGG + Intronic
1066220199 10:33330463-33330485 CTCCTTCCTGTTAGCACTTTTGG - Intronic
1067366870 10:45639751-45639773 CTCATTGCTGAGTGCTCTGCAGG + Intronic
1067849350 10:49744953-49744975 CCCCTTGCTGAGCGCACTGCAGG - Intronic
1068599670 10:58943038-58943060 CTTCATCCTGAAGGCACTGCAGG + Intergenic
1069757957 10:70785321-70785343 CTCCTTCCTGCTAGGACAGCAGG - Exonic
1070682113 10:78455984-78456006 CACCCTCCTGATGGCATTGCAGG + Intergenic
1070923793 10:80205209-80205231 CGGCTTCCTGGTTGCACTACAGG - Intronic
1071272020 10:84016672-84016694 CTCCTCCCTGGTAGCACTGTTGG - Intergenic
1071716925 10:88106486-88106508 CTCCTTCCTAAATGCACTCTAGG - Intergenic
1072476014 10:95760542-95760564 CTTAATCATGATTGCACTGCGGG + Intronic
1072686083 10:97537758-97537780 CTCCTTTCTGCTTCTACTGCAGG - Intronic
1073155088 10:101339979-101340001 CTCCCTGCTGATTCCAGTGCTGG - Intergenic
1075422739 10:122315282-122315304 CTCTATCTTGATTGCAGTGCTGG - Intronic
1075977204 10:126706304-126706326 CTCCTGCCTGCTGGCCCTGCTGG - Intergenic
1077852295 11:6085089-6085111 CCCCTGCCTGGTTGCTCTGCAGG - Intergenic
1079551517 11:21704704-21704726 CTGCTTGCTGTTTGCACAGCAGG + Intergenic
1080098021 11:28430348-28430370 CTCCTCCCGGATGGCACGGCTGG - Intergenic
1083855959 11:65393217-65393239 CTGCTTCCTGATGGCACTGAGGG + Intronic
1084187790 11:67483973-67483995 GTCCTGCCTGACTGCTCTGCTGG - Intronic
1084719397 11:70894646-70894668 CCCCTTCCTCTTTGCAGTGCAGG + Intronic
1084767306 11:71321091-71321113 CCCCTTCCTGCTTCCACCGCAGG + Intergenic
1085511608 11:77091024-77091046 CTCCTTCCAGTTGGCACTACAGG - Intronic
1085609083 11:77930525-77930547 TTCCTTCCTGATTGCCTTGGTGG - Intronic
1086591526 11:88520987-88521009 CTCCTTCCTTCTGGCACTGGAGG + Intronic
1087927755 11:103939553-103939575 CTCCTGCCTGATTGCCCTGGAGG + Intronic
1089152364 11:116373810-116373832 TTCCTTCCTGAGTCTACTGCAGG - Intergenic
1089394961 11:118130675-118130697 ATCTTTCCTGTTAGCACTGCGGG + Intergenic
1090363947 11:126190967-126190989 CTCCTTCGTGGAAGCACTGCGGG + Intergenic
1091112560 11:132983430-132983452 CGCCTTTCTTCTTGCACTGCTGG - Intronic
1091646783 12:2278334-2278356 CACCCTCTTGATTGCACTGATGG - Intronic
1092074644 12:5663076-5663098 CTCCTTCCTGCGTGGCCTGCAGG + Intronic
1092102533 12:5897627-5897649 ATTCTTCCTCATTGCTCTGCTGG - Intronic
1095322834 12:40850413-40850435 CTCCTTCTGGATAGCCCTGCAGG - Intronic
1100024578 12:90112291-90112313 CTCTGTCTTGATTACACTGCAGG + Intergenic
1103454635 12:121055322-121055344 CTCCATCTTGATTGCAGTGGTGG - Intergenic
1104436196 12:128758497-128758519 CTCCAGCCTGACTGCCCTGCTGG - Intergenic
1106251677 13:27986815-27986837 CTCCTTCCGGCCTGCCCTGCAGG + Intronic
1106414587 13:29535963-29535985 CTCCTTCCTGATCGCTGCGCTGG - Exonic
1107749357 13:43547878-43547900 GTCTTTCCTGATTGCACTGGGGG - Intronic
1112611378 13:100957988-100958010 ATCCTTCCTGTTTTCACAGCAGG + Intergenic
1116284072 14:42949692-42949714 CTCCTGCCTGATTGCTTGGCTGG - Intergenic
1118226554 14:63905795-63905817 CTCTTGCCTGATTGCTCTGGCGG + Intronic
1118808680 14:69258772-69258794 CTGCTTCCTGCTGGCACTGCTGG - Intergenic
1119237013 14:73028109-73028131 CTCTTTCCTGATTTCTCTGAAGG + Intergenic
1122099232 14:99394155-99394177 CTGGTTCCTGACTGCAGTGCTGG - Intergenic
1122100836 14:99408518-99408540 CTCCCTCCTGTTTGTGCTGCTGG - Intronic
1122536326 14:102466065-102466087 CTCTTTCCTGACTCCACTGAAGG - Intronic
1123806254 15:23877128-23877150 CTCCATCCTCAATCCACTGCAGG - Intergenic
1124206993 15:27729567-27729589 TTCCTTCCTGTTTGAATTGCTGG + Intergenic
1126499804 15:49332952-49332974 CTCCTTGCTGATTGCTCTTTAGG + Intronic
1128695179 15:69756407-69756429 CTCCTTCGTGTCTGTACTGCAGG - Intergenic
1128806450 15:70534503-70534525 TTCCTTCCTCTTTGCAGTGCTGG - Intergenic
1128903666 15:71448695-71448717 GTCCTTCCTGCTTTCTCTGCAGG + Intronic
1131389793 15:92037754-92037776 CTAGTTCCTGAATGAACTGCTGG - Intronic
1131994384 15:98120090-98120112 CTGCTTCCTCATCCCACTGCTGG + Intergenic
1133051409 16:3119356-3119378 CTGCTTCCTGCGCGCACTGCGGG - Exonic
1138188598 16:54996125-54996147 CCCCTTCCTGATTGCAAGGAGGG - Intergenic
1138596446 16:58031656-58031678 CTCCTTCCTGCTTCTCCTGCTGG + Intronic
1140691782 16:77491734-77491756 CAGATTCCTGATTGCCCTGCTGG - Intergenic
1141205333 16:81929060-81929082 CTGCTTCCTGGTTGCTCGGCTGG + Intronic
1141836494 16:86543592-86543614 CCCCTTCCTGTCAGCACTGCGGG - Intronic
1145799189 17:27672365-27672387 CTCCTTCCTGGCTCCCCTGCCGG - Intergenic
1145889516 17:28405144-28405166 CACCTTCCGGATGGCCCTGCTGG - Exonic
1146844548 17:36174577-36174599 CTCCTCCCTGACTCCCCTGCAGG - Intronic
1146856852 17:36262512-36262534 CTCCTCCCTGACTCCCCTGCAGG - Intronic
1146863765 17:36325863-36325885 CTCCTCCCTGACTCCCCTGCAGG + Intronic
1146872762 17:36386422-36386444 CTCCTCCCTGACTCCCCTGCAGG - Intronic
1146880121 17:36437508-36437530 CTCCTCCCTGACTCCCCTGCAGG - Intronic
1147066626 17:37926451-37926473 CTCCTCCCTGACTCCCCTGCAGG + Intronic
1147075645 17:37987047-37987069 CTCCTCCCTGACTCCCCTGCAGG - Intronic
1147078158 17:38006012-38006034 CTCCTCCCTGACTCCCCTGCAGG + Intronic
1147087170 17:38066593-38066615 CTCCTCCCTGACTCCCCTGCAGG - Intronic
1147094094 17:38129947-38129969 CTCCTCCCTGACTCCCCTGCAGG + Intergenic
1147103115 17:38190556-38190578 CTCCTCCCTGACTCCCCTGCAGG - Intergenic
1147880092 17:43647798-43647820 CTTCTTCCTGTTTCCTCTGCTGG - Intronic
1148218337 17:45846034-45846056 CTCCTTCCTGCTGGCCCTGCTGG + Exonic
1148871488 17:50661007-50661029 CTCCTTCCTGAAGGCCCTGCTGG + Exonic
1149847691 17:60017025-60017047 CTCCTCCCTGACTCCCCTGCAGG - Intergenic
1150086050 17:62273642-62273664 CTCCTCCCTGACTCCCCTGCAGG - Intronic
1150131872 17:62673911-62673933 CGCCTTCCCCATTGCACAGCTGG + Intronic
1151786243 17:76276420-76276442 CTCCATCCCGGCTGCACTGCTGG - Intronic
1152672204 17:81615558-81615580 CTGCTGTCTGAGTGCACTGCTGG - Intronic
1152784018 17:82238769-82238791 CTCCTCCCTGATTTTGCTGCTGG + Exonic
1153927386 18:9846220-9846242 CTCCTTCCTGGTCCCAGTGCTGG + Intronic
1156943041 18:42794171-42794193 CTCCTTCCAGAGTGCCCTGCAGG + Intronic
1159397299 18:67877069-67877091 CTGCATTCTGTTTGCACTGCAGG + Intergenic
1160235827 18:77085980-77086002 CTCTCTCCTTATTGCACTGAGGG - Intronic
1161876356 19:6914119-6914141 GTACTTCCTGTTTGCCCTGCTGG + Intronic
1163044118 19:14626661-14626683 CTGCTTCCTCATTGCCCTACTGG - Intronic
1163202674 19:15779912-15779934 CTCCATCCTGTCTGCCCTGCAGG - Intergenic
1163516919 19:17770418-17770440 CCACTTCCTCCTTGCACTGCGGG - Exonic
1165981252 19:39726301-39726323 AGCCTTCCTGATGACACTGCAGG + Intergenic
1166592095 19:44008615-44008637 CTTTTTCATGATTGCACTTCTGG + Intronic
1167967973 19:53163385-53163407 CATCATCCTTATTGCACTGCAGG - Intronic
925668791 2:6290116-6290138 CTCCCTCCTGGGTGCTCTGCTGG + Intergenic
930024206 2:47020522-47020544 CTGCTTCCTGATTGCTGGGCTGG - Intronic
932244053 2:70181505-70181527 CTCGGTCCTGAATGCAATGCAGG - Exonic
932877334 2:75466852-75466874 CTCCTTCCTGATTTCCATGAAGG - Intergenic
935189637 2:100766503-100766525 TTCCTCCCTGACTGCACTGGAGG + Intergenic
935325197 2:101929346-101929368 CTCCTCCCTGATTGCAGCTCAGG + Intergenic
935933529 2:108155821-108155843 CTCCTTACTCACTGCAATGCTGG + Intergenic
936700089 2:115001538-115001560 CTCTTGCCTGATTGCTCTGTCGG - Intronic
937636624 2:124163277-124163299 CACCTTCCTCATTGCAATGTTGG - Intronic
938002775 2:127757899-127757921 CCCCTTCATGATTGCATTGGTGG - Intronic
939369779 2:141284160-141284182 CTTCTTTTTTATTGCACTGCTGG - Intronic
940149715 2:150585989-150586011 CTTCTTCCTGGTTGAACTGATGG + Intergenic
940281324 2:151992699-151992721 TTGCTTCCTGATTGCAATGGTGG - Intronic
941605825 2:167595193-167595215 TTCCTTCATGACTGCTCTGCTGG - Intergenic
944501473 2:200364712-200364734 CTCCTTTCTGCCTGGACTGCAGG + Intronic
944945645 2:204681749-204681771 CTCCTTCCTGGGTGCATTGTGGG + Intronic
946546712 2:220751930-220751952 CTCTTGCCTGATTGCCCTGGCGG - Intergenic
948600814 2:239106588-239106610 CTCCTCCCAGAGGGCACTGCAGG + Intronic
1171251556 20:23653013-23653035 CTCCTTCCTGACTCCCCTCCAGG - Intergenic
1172149827 20:32782086-32782108 CTTCTTCATGATTTCACGGCTGG - Intronic
1175296132 20:57910002-57910024 CACCTCCCTCATTGCAGTGCTGG + Intergenic
1175427602 20:58878784-58878806 CTCCTTCCAGACAGAACTGCCGG - Intronic
1180134691 21:45854931-45854953 CTCCTGCCTGAGTTCACAGCAGG + Intronic
1181559081 22:23689377-23689399 CTCCTGCCTGATGGGGCTGCAGG - Intronic
1181866954 22:25866034-25866056 TTCCTTCCTGATTGCAGTCTGGG + Intronic
1182618600 22:31605316-31605338 CCCCTTCCAGCTTGCTCTGCAGG + Intronic
1183131247 22:35838911-35838933 CTCCTTCCAAACAGCACTGCAGG + Intronic
1183372395 22:37441202-37441224 CTTCTTCCTGTTTGGAATGCTGG + Intergenic
1184562336 22:45270388-45270410 CTCCCTCCTGAGTGCACCACAGG - Intergenic
1184845730 22:47084434-47084456 CTCATTCCTGAGTGATCTGCGGG + Intronic
950429277 3:12941564-12941586 CTCCTACCTGCTTGTCCTGCAGG + Exonic
951699407 3:25479889-25479911 CTTCCTCGTTATTGCACTGCTGG - Intronic
952205220 3:31174642-31174664 GTCCTTCCTGATTGGTCTGTAGG - Intergenic
954361217 3:50123891-50123913 CTCCTTCCTGTCCTCACTGCAGG - Intergenic
955409762 3:58647915-58647937 CAACTTCCTGATTTCACAGCTGG - Intronic
958827516 3:99049483-99049505 CTCTTTCTTTCTTGCACTGCAGG + Intergenic
959419384 3:106111944-106111966 CTCCTCCCGGATGGCACGGCTGG + Intergenic
959419404 3:106111991-106112013 CTCCTCCCGGATGGCACGGCTGG + Intergenic
961055042 3:123780611-123780633 CTCCTTCCAGATCACACTGTTGG + Intronic
962727154 3:138241389-138241411 ATCATTCCTGATTAAACTGCTGG + Intronic
963906649 3:150778899-150778921 CTCCTTCCGGTTTGAACTGGGGG - Intergenic
972322661 4:37986790-37986812 CTCCTTGCTCATTTCCCTGCAGG - Intronic
972417718 4:38859090-38859112 ATCGTTCCAGCTTGCACTGCTGG + Intergenic
974014033 4:56633049-56633071 TTCCTTCCTGCTGGCACTGGTGG - Intergenic
974796103 4:66752294-66752316 CTCCTTCCTGATTTTATTCCTGG + Intergenic
975291002 4:72678251-72678273 CTCCTTCCTGGGTGCAGTGCTGG + Intergenic
976916148 4:90376905-90376927 CTCCTTCCAGAATGAACAGCAGG + Intronic
978914609 4:114109122-114109144 CTCTATCCAGATGGCACTGCTGG + Intergenic
981994147 4:150957958-150957980 CTCCTTGCTGCTTTCACGGCTGG + Intronic
985119251 4:186623303-186623325 GTCCTTCCTGATTGCATTTTTGG + Intronic
991958038 5:72015140-72015162 CTTGTTCCTGCCTGCACTGCTGG - Intergenic
993487266 5:88502290-88502312 CTGGTTCATCATTGCACTGCAGG + Intergenic
993816339 5:92551602-92551624 ATACTTACTGATTGCACTGTGGG - Intergenic
994183050 5:96788667-96788689 CCCCTTCCTGATGCCAATGCTGG + Exonic
997669439 5:135658413-135658435 CTCCATCCCTATGGCACTGCAGG + Intergenic
999245750 5:150153772-150153794 CTCCTCCCTGCTTGCAATGGAGG + Intronic
1001257558 5:170196008-170196030 CTCCACCCTGATTTCACAGCTGG + Intergenic
1002304033 5:178273027-178273049 CTCCATCCTGTCTGCACTGCAGG + Intronic
1003657415 6:8025447-8025469 CTGCTTCCTGACTGGCCTGCGGG + Intronic
1005059594 6:21763369-21763391 CTCCCACCTGCTTGGACTGCAGG + Intergenic
1006815969 6:36850136-36850158 CTACTTCCTCATTACACTGACGG - Intergenic
1007911912 6:45524118-45524140 CGCCTTCCTGTTTGCATTTCAGG - Intronic
1009393786 6:63173225-63173247 CTCCTTCATAATTGTACTTCTGG + Intergenic
1012474441 6:99604648-99604670 CCCCTTCCCGCTTGCAGTGCTGG + Intergenic
1013554555 6:111242739-111242761 CTGCTTCTTGAGTGCACTTCAGG + Intergenic
1015525482 6:134171855-134171877 TTCCTTCCTGATAAAACTGCTGG + Intronic
1015996991 6:139005320-139005342 CTCCTTCCGGAAGGAACTGCAGG + Intergenic
1018860563 6:167708203-167708225 CTCCTTCCTGAATACCCTCCAGG + Intergenic
1018967469 6:168499819-168499841 CTCCTTCCTGATTGCACTGCTGG - Intronic
1019154993 6:170032748-170032770 CTCCTTCCAGAGTGCTCTGCAGG + Intergenic
1020954875 7:14728532-14728554 CTCTTTCCTCATTCCACTCCAGG + Intronic
1022312902 7:29214041-29214063 CTCCTTCCTGATTCCAAAGATGG + Intronic
1023729477 7:43176890-43176912 CTGCTTCGTAATTGCAATGCAGG - Intronic
1025843814 7:65177285-65177307 TTCCTTCCTGATTGCCTTGGTGG + Intergenic
1025894147 7:65683596-65683618 TTCCTTCCTGATTGCCTTGGTGG + Intergenic
1028140899 7:87273973-87273995 CTCCATCCTGGTGGCTCTGCAGG + Intergenic
1029746215 7:102517149-102517171 CTCCTACCCGAGTGCACAGCAGG + Intronic
1029764153 7:102616128-102616150 CTCCTACCCGAGTGCACAGCAGG + Intronic
1029818114 7:103117744-103117766 CCCTTTCCTGCTTGCATTGCAGG - Intronic
1031116421 7:117673650-117673672 CTCCTACCTGGTTGCGCCGCTGG + Intronic
1035241465 7:157533328-157533350 ATCTTGCCTGATTGCTCTGCTGG + Intergenic
1035380145 7:158432851-158432873 CTCGTTCCTGTTTTCACTCCAGG - Intronic
1035732381 8:1862173-1862195 TTCCTGCCTGGTGGCACTGCTGG + Intronic
1036016324 8:4788859-4788881 CTCCTTCCTGACTCCAGGGCAGG + Intronic
1044949187 8:97418797-97418819 GTCCTTCTTGATTTCACTGTTGG - Intergenic
1045281162 8:100750758-100750780 CTCCTTCCTCTCAGCACTGCAGG + Intergenic
1046306511 8:112373882-112373904 AGCCTTTCTGATTGCCCTGCTGG + Intronic
1047262488 8:123274796-123274818 CGCCTTCCTAATGTCACTGCTGG + Intronic
1047947300 8:129894480-129894502 CTCCTACCTTTCTGCACTGCTGG + Intronic
1049211024 8:141386439-141386461 CTCCGTCCTCTCTGCACTGCAGG - Intergenic
1050860668 9:10425756-10425778 CACCTTCTTGATTAGACTGCTGG - Intronic
1051573213 9:18583692-18583714 CTCCGTCCTGGTGGCTCTGCAGG - Intronic
1056887281 9:90455590-90455612 CTCCTTCCTGTTTGTTTTGCTGG + Intergenic
1057194131 9:93107345-93107367 CTATTTCCTGATGGCCCTGCAGG + Intronic
1058926704 9:109672101-109672123 CTCTTGCCTGATTACCCTGCAGG + Intronic
1061845899 9:133387966-133387988 CTGCTGCCTGATTGCGCTGCAGG + Intronic
1185526592 X:785024-785046 CTTCTTCGTGCTTGCACTCCGGG - Intergenic
1185982987 X:4799728-4799750 CTCCTCCATGATTCCAATGCTGG + Intergenic
1186273549 X:7916412-7916434 TTCCTTCCTGATTCCTCTCCTGG - Intronic
1188243819 X:27818736-27818758 CTCCTTATTGAATGGACTGCAGG + Intronic
1188860624 X:35251444-35251466 CTCCTTCTTGCTGGCACTGGTGG - Intergenic
1200111118 X:153741444-153741466 CTGCTTCCAGCCTGCACTGCTGG + Intronic