ID: 1018967717

View in Genome Browser
Species Human (GRCh38)
Location 6:168501542-168501564
Sequence CATTCTGCAGAATGTGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018967709_1018967717 7 Left 1018967709 6:168501512-168501534 CCCTCGCTATGGGGCCAGGAACC 0: 2
1: 0
2: 1
3: 6
4: 95
Right 1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG No data
1018967710_1018967717 6 Left 1018967710 6:168501513-168501535 CCTCGCTATGGGGCCAGGAACCT 0: 2
1: 0
2: 1
3: 7
4: 90
Right 1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG No data
1018967703_1018967717 28 Left 1018967703 6:168501491-168501513 CCAGGAACCTGCATCATCTGTCC 0: 1
1: 3
2: 11
3: 17
4: 164
Right 1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG No data
1018967704_1018967717 21 Left 1018967704 6:168501498-168501520 CCTGCATCATCTGTCCCTCGCTA 0: 1
1: 0
2: 2
3: 5
4: 141
Right 1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG No data
1018967711_1018967717 -7 Left 1018967711 6:168501526-168501548 CCAGGAACCTGAAGCCCATTCTG 0: 1
1: 0
2: 1
3: 24
4: 170
Right 1018967717 6:168501542-168501564 CATTCTGCAGAATGTGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018967717 Original CRISPR CATTCTGCAGAATGTGAGGT GGG Intronic
No off target data available for this crispr