ID: 1018968076

View in Genome Browser
Species Human (GRCh38)
Location 6:168504146-168504168
Sequence GCTTCTCATCCAGCTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018968073_1018968076 -2 Left 1018968073 6:168504125-168504147 CCTGGGATGCCAGCTCACATGGC 0: 1
1: 0
2: 2
3: 15
4: 194
Right 1018968076 6:168504146-168504168 GCTTCTCATCCAGCTCCTCTGGG 0: 1
1: 0
2: 3
3: 18
4: 272
1018968071_1018968076 -1 Left 1018968071 6:168504124-168504146 CCCTGGGATGCCAGCTCACATGG 0: 1
1: 0
2: 1
3: 18
4: 166
Right 1018968076 6:168504146-168504168 GCTTCTCATCCAGCTCCTCTGGG 0: 1
1: 0
2: 3
3: 18
4: 272
1018968066_1018968076 27 Left 1018968066 6:168504096-168504118 CCTTGACACATCCACGTCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 173
Right 1018968076 6:168504146-168504168 GCTTCTCATCCAGCTCCTCTGGG 0: 1
1: 0
2: 3
3: 18
4: 272
1018968068_1018968076 16 Left 1018968068 6:168504107-168504129 CCACGTCTGTGGATTTGCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1018968076 6:168504146-168504168 GCTTCTCATCCAGCTCCTCTGGG 0: 1
1: 0
2: 3
3: 18
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018968076 Original CRISPR GCTTCTCATCCAGCTCCTCT GGG Intronic