ID: 1018968544

View in Genome Browser
Species Human (GRCh38)
Location 6:168508440-168508462
Sequence TGGAGCTAACTCGGCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018968544_1018968554 16 Left 1018968544 6:168508440-168508462 CCAGCCTTGCCGAGTTAGCTCCA 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1018968554 6:168508479-168508501 GGTGATCCGCAGCCACAGAGGGG No data
1018968544_1018968552 14 Left 1018968544 6:168508440-168508462 CCAGCCTTGCCGAGTTAGCTCCA 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1018968552 6:168508477-168508499 CTGGTGATCCGCAGCCACAGAGG No data
1018968544_1018968553 15 Left 1018968544 6:168508440-168508462 CCAGCCTTGCCGAGTTAGCTCCA 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data
1018968544_1018968547 -5 Left 1018968544 6:168508440-168508462 CCAGCCTTGCCGAGTTAGCTCCA 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1018968547 6:168508458-168508480 CTCCACTGACACAACCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018968544 Original CRISPR TGGAGCTAACTCGGCAAGGC TGG (reversed) Intronic