ID: 1018968545

View in Genome Browser
Species Human (GRCh38)
Location 6:168508444-168508466
Sequence TCAGTGGAGCTAACTCGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018968545_1018968553 11 Left 1018968545 6:168508444-168508466 CCTTGCCGAGTTAGCTCCACTGA 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data
1018968545_1018968552 10 Left 1018968545 6:168508444-168508466 CCTTGCCGAGTTAGCTCCACTGA 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1018968552 6:168508477-168508499 CTGGTGATCCGCAGCCACAGAGG No data
1018968545_1018968554 12 Left 1018968545 6:168508444-168508466 CCTTGCCGAGTTAGCTCCACTGA 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1018968554 6:168508479-168508501 GGTGATCCGCAGCCACAGAGGGG No data
1018968545_1018968547 -9 Left 1018968545 6:168508444-168508466 CCTTGCCGAGTTAGCTCCACTGA 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1018968547 6:168508458-168508480 CTCCACTGACACAACCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018968545 Original CRISPR TCAGTGGAGCTAACTCGGCA AGG (reversed) Intronic