ID: 1018968546

View in Genome Browser
Species Human (GRCh38)
Location 6:168508449-168508471
Sequence TTGTGTCAGTGGAGCTAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018968546_1018968554 7 Left 1018968546 6:168508449-168508471 CCGAGTTAGCTCCACTGACACAA 0: 1
1: 0
2: 1
3: 12
4: 97
Right 1018968554 6:168508479-168508501 GGTGATCCGCAGCCACAGAGGGG No data
1018968546_1018968557 26 Left 1018968546 6:168508449-168508471 CCGAGTTAGCTCCACTGACACAA 0: 1
1: 0
2: 1
3: 12
4: 97
Right 1018968557 6:168508498-168508520 GGGGTACAATGCTGATTAGCTGG 0: 1
1: 0
2: 3
3: 51
4: 532
1018968546_1018968558 27 Left 1018968546 6:168508449-168508471 CCGAGTTAGCTCCACTGACACAA 0: 1
1: 0
2: 1
3: 12
4: 97
Right 1018968558 6:168508499-168508521 GGGTACAATGCTGATTAGCTGGG No data
1018968546_1018968553 6 Left 1018968546 6:168508449-168508471 CCGAGTTAGCTCCACTGACACAA 0: 1
1: 0
2: 1
3: 12
4: 97
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data
1018968546_1018968552 5 Left 1018968546 6:168508449-168508471 CCGAGTTAGCTCCACTGACACAA 0: 1
1: 0
2: 1
3: 12
4: 97
Right 1018968552 6:168508477-168508499 CTGGTGATCCGCAGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018968546 Original CRISPR TTGTGTCAGTGGAGCTAACT CGG (reversed) Intronic