ID: 1018968548

View in Genome Browser
Species Human (GRCh38)
Location 6:168508460-168508482
Sequence CACCAGGTGGGTTGTGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 140}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018968548_1018968554 -4 Left 1018968548 6:168508460-168508482 CCACTGACACAACCCACCTGGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1018968554 6:168508479-168508501 GGTGATCCGCAGCCACAGAGGGG No data
1018968548_1018968553 -5 Left 1018968548 6:168508460-168508482 CCACTGACACAACCCACCTGGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data
1018968548_1018968558 16 Left 1018968548 6:168508460-168508482 CCACTGACACAACCCACCTGGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1018968558 6:168508499-168508521 GGGTACAATGCTGATTAGCTGGG No data
1018968548_1018968552 -6 Left 1018968548 6:168508460-168508482 CCACTGACACAACCCACCTGGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1018968552 6:168508477-168508499 CTGGTGATCCGCAGCCACAGAGG No data
1018968548_1018968557 15 Left 1018968548 6:168508460-168508482 CCACTGACACAACCCACCTGGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1018968557 6:168508498-168508520 GGGGTACAATGCTGATTAGCTGG 0: 1
1: 0
2: 3
3: 51
4: 532

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018968548 Original CRISPR CACCAGGTGGGTTGTGTCAG TGG (reversed) Intronic