ID: 1018968553

View in Genome Browser
Species Human (GRCh38)
Location 6:168508478-168508500
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018968548_1018968553 -5 Left 1018968548 6:168508460-168508482 CCACTGACACAACCCACCTGGTG 0: 1
1: 0
2: 1
3: 9
4: 140
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data
1018968544_1018968553 15 Left 1018968544 6:168508440-168508462 CCAGCCTTGCCGAGTTAGCTCCA 0: 1
1: 0
2: 0
3: 1
4: 78
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data
1018968543_1018968553 21 Left 1018968543 6:168508434-168508456 CCACAGCCAGCCTTGCCGAGTTA 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data
1018968546_1018968553 6 Left 1018968546 6:168508449-168508471 CCGAGTTAGCTCCACTGACACAA 0: 1
1: 0
2: 1
3: 12
4: 97
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data
1018968545_1018968553 11 Left 1018968545 6:168508444-168508466 CCTTGCCGAGTTAGCTCCACTGA 0: 1
1: 0
2: 1
3: 3
4: 66
Right 1018968553 6:168508478-168508500 TGGTGATCCGCAGCCACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type