ID: 1018973135

View in Genome Browser
Species Human (GRCh38)
Location 6:168542900-168542922
Sequence TGCCCAGTAAAACTCCTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018973135_1018973140 -7 Left 1018973135 6:168542900-168542922 CCCCTGAGGAGTTTTACTGGGCA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1018973140 6:168542916-168542938 CTGGGCATGTGTATGGCTATGGG 0: 1
1: 0
2: 1
3: 13
4: 138
1018973135_1018973139 -8 Left 1018973135 6:168542900-168542922 CCCCTGAGGAGTTTTACTGGGCA 0: 1
1: 0
2: 0
3: 13
4: 128
Right 1018973139 6:168542915-168542937 ACTGGGCATGTGTATGGCTATGG 0: 1
1: 0
2: 1
3: 11
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018973135 Original CRISPR TGCCCAGTAAAACTCCTCAG GGG (reversed) Intronic
900609169 1:3537209-3537231 AGCCCAGTCTACCTCCTCAGCGG + Intronic
902595880 1:17509071-17509093 TTGCCAATAAAGCTCCTCAGTGG - Intergenic
905887099 1:41497237-41497259 TGCCCAGTCAAACTGCCCTGGGG - Intergenic
907698696 1:56761019-56761041 TGCACAATAAAACTAATCAGTGG - Intronic
909121257 1:71607166-71607188 TTCCCAGTTAAAGACCTCAGAGG + Intronic
911274625 1:95846383-95846405 GCCTCAGTAAAACTTCTCAGAGG + Intergenic
913328231 1:117646351-117646373 TGCCCAGTAAGGCTGCCCAGTGG - Intergenic
914321690 1:146569020-146569042 CACCCAGTAAAGCTCCTCTGAGG - Intergenic
920426639 1:205882561-205882583 TGCCCAGTTATACTTCTTAGAGG + Intergenic
921185775 1:212667991-212668013 TCCCCACTCAAAGTCCTCAGGGG - Intergenic
922042953 1:221915096-221915118 TTCTCTGAAAAACTCCTCAGGGG + Intergenic
1064586603 10:16845401-16845423 TGCCCAGCAGACCTCATCAGAGG - Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1069051643 10:63801338-63801360 TGGCCACTAAAAGTCCACAGAGG - Intergenic
1072070351 10:91909166-91909188 TCCCCAGGAAAGCTCCTCAGAGG - Intronic
1073323106 10:102627642-102627664 TGCCCACCAGAACTCCCCAGCGG - Intronic
1073493240 10:103869381-103869403 AACCAAATAAAACTCCTCAGAGG + Intergenic
1073507133 10:104006434-104006456 TGAGCAGTAGGACTCCTCAGGGG + Intronic
1076373449 10:129968797-129968819 TGCCCAGTAACTTGCCTCAGAGG - Intergenic
1082875105 11:57980010-57980032 TGACCAGAAAAACTCCACTGTGG - Intergenic
1087414684 11:97839125-97839147 TGCCCAGTCTAAATCCCCAGGGG + Intergenic
1088676044 11:112194616-112194638 TGCCCATTAAAAATCTCCAGTGG + Intronic
1089787517 11:120918632-120918654 TGCCCACTAAGTCTGCTCAGAGG + Intronic
1090945557 11:131426469-131426491 TGCTCAGTACAACTTCTCAGAGG - Intronic
1091756642 12:3056683-3056705 TTCCCAGTCAAAATCCTCAGGGG + Intergenic
1094014977 12:25852851-25852873 TGCCCAGTATAACAACTCAGAGG + Intergenic
1096520221 12:52180798-52180820 TGCCCAATCAAAGCCCTCAGAGG - Intronic
1099496221 12:83350244-83350266 TGCCAAGTAGAAGTACTCAGGGG - Intergenic
1099869753 12:88332034-88332056 TGCCCAGAATAGCACCTCAGAGG + Intergenic
1101224217 12:102671427-102671449 GGCCCATTATATCTCCTCAGTGG - Intergenic
1103546915 12:121708800-121708822 TTCCCATTACAAATCCTCAGAGG + Intergenic
1112271371 13:97973493-97973515 TGTCCAGAAAACCTCCTAAGTGG - Intronic
1113435906 13:110290901-110290923 TGGCCAGTGAAACTCGGCAGGGG + Intronic
1114747695 14:25167790-25167812 TTCCCAGTTAAGCTACTCAGTGG - Intergenic
1118109645 14:62702715-62702737 TTCCCAGTCCAAATCCTCAGTGG + Exonic
1121794137 14:96721656-96721678 TGCCAAGTAAGGCTGCTCAGTGG - Intergenic
1122403156 14:101479342-101479364 GGCCCAGGAAAGCTCCTCAAAGG - Intergenic
1130209028 15:81906337-81906359 AACCCAGTAAAACTTCACAGAGG + Intergenic
1131057343 15:89383522-89383544 TGCCCATTCAAACTCCACTGGGG - Intergenic
1131376695 15:91930287-91930309 GGCACAGTGAAACTCATCAGAGG - Intronic
1132163484 15:99564640-99564662 GGCCCCGAAAAACTCTTCAGAGG + Intergenic
1133338258 16:5020611-5020633 TGCCCAGCACAGCTCGTCAGGGG + Intergenic
1133521510 16:6562713-6562735 TGCCCTTTAAAACTCCTTGGAGG + Intronic
1134358229 16:13504685-13504707 TGCCCAGTTGAAATCCTCTGAGG - Intergenic
1135534515 16:23282845-23282867 TGCCCAGAAAAGCAGCTCAGAGG - Intronic
1136391763 16:29969835-29969857 TCCTCCTTAAAACTCCTCAGTGG - Intronic
1140011939 16:71142124-71142146 CACCCAGTAAAGCTCCTCTGAGG + Intronic
1142786069 17:2223885-2223907 TGCCCAGTCACACTGCTCATGGG + Intronic
1150471638 17:65442512-65442534 GGCCCAGCAAAAGTCCCCAGGGG - Intergenic
1151014433 17:70537713-70537735 TTCCCAGTGTAACTTCTCAGTGG + Intergenic
1152212129 17:79008319-79008341 TTCTCAGCAAAGCTCCTCAGAGG + Intronic
1157868760 18:51210045-51210067 TGCACAGTAAAACTTCCCAAAGG + Intronic
1159057514 18:63480753-63480775 TGCCCGGTAAATCTGATCAGTGG - Intronic
1159393975 18:67831835-67831857 TGCCCAGTAATACTATTCAAGGG - Intergenic
927091226 2:19714243-19714265 TGCCCAAAAAAACTCAACAGTGG + Intergenic
927313470 2:21655685-21655707 TTCCCAGAAAAAATCTTCAGTGG + Intergenic
932298062 2:70643159-70643181 TGCCCAGCAAACCTGCTTAGGGG - Intronic
933520256 2:83362839-83362861 TTCCTAGTTAAACTCCTTAGAGG + Intergenic
934538671 2:95157702-95157724 TGCCCAGTAAATAACTTCAGTGG - Intronic
935395725 2:102606595-102606617 GGCCCAGTGAAACTTCTCACAGG + Intergenic
935832041 2:107010550-107010572 TACCCAGGAAAACGCCCCAGAGG - Intergenic
938961896 2:136351596-136351618 TGCCCAGTAACACCCCTCTAGGG - Intergenic
939472802 2:142646057-142646079 TGCACAATAGAACTCATCAGAGG - Intergenic
940324843 2:152414425-152414447 TGCCCAGTATCACTTCTCCGTGG + Intronic
946239628 2:218345648-218345670 TGCCAAGGAAACCTCCTCATTGG + Exonic
947617176 2:231565658-231565680 TGCCCAGAATAACAGCTCAGAGG + Intergenic
948156160 2:235783747-235783769 GGCCCAGAGGAACTCCTCAGGGG + Intronic
1168833471 20:860455-860477 TGCCCAGAACTACTCCACAGAGG - Intergenic
1169535112 20:6530363-6530385 TGACCAGTAAATCTCAACAGTGG + Intergenic
1172611367 20:36255303-36255325 TGTCCAGTAGAACCCCCCAGGGG + Intronic
1176248260 20:64107685-64107707 TACCCAGGCAGACTCCTCAGTGG + Intergenic
1177743824 21:25186571-25186593 TACCAAGTGAATCTCCTCAGGGG + Intergenic
1178174727 21:30083467-30083489 TGCCCAGAAAAGCAGCTCAGAGG - Intergenic
1178204128 21:30443393-30443415 TTCCCAGTAAAAGTTTTCAGAGG - Intergenic
1181273379 22:21673781-21673803 GGCCCAGGAACTCTCCTCAGAGG - Intronic
1181643149 22:24215308-24215330 TGCCCATGAAGACTGCTCAGAGG + Intergenic
1183480115 22:38059153-38059175 GGCCCTCTAAAACTCCTGAGGGG - Intronic
1185024218 22:48398395-48398417 TTCCCAGTAAAACTCCTCGTGGG + Intergenic
1185171915 22:49299230-49299252 TGCCCAGCACAGCTTCTCAGGGG + Intergenic
950541409 3:13615391-13615413 TGCCCAGGACAAATCCACAGGGG - Intronic
953151463 3:40329053-40329075 TGCCCAGTAAAACTTGTTTGTGG + Intergenic
955919768 3:63943353-63943375 GGCCCAATTAATCTCCTCAGTGG - Intronic
957809992 3:85209332-85209354 TTCCCAGTAAAAGTCTTCTGAGG + Intronic
961239273 3:125396386-125396408 TTCCCAGTAAAAATGCTCAGTGG + Intergenic
962316480 3:134362686-134362708 TGCCCAAAGAAACTGCTCAGAGG + Intronic
963361212 3:144274246-144274268 TCCCCACTAAAACTCAACAGTGG - Intergenic
968808101 4:2788062-2788084 TGCTCAGAAAACATCCTCAGTGG - Intergenic
970274938 4:14388597-14388619 TTCCTAGTAAAACACCTCTGTGG - Intergenic
975300680 4:72787264-72787286 TGCCCAGCAAGGCTCCTCAGTGG - Intergenic
977731230 4:100354606-100354628 TTCCTAGTATAGCTCCTCAGAGG + Intergenic
979301708 4:119094347-119094369 TGCCCAGTAGAATACTTCAGTGG + Intergenic
984166051 4:176304300-176304322 TGACCAGTAAAATGCTTCAGGGG + Intergenic
984937769 4:184904270-184904292 AGCCCAGAGCAACTCCTCAGGGG + Intergenic
987841175 5:23224370-23224392 TGCTCACTACAAATCCTCAGTGG - Intergenic
992246239 5:74826476-74826498 GGCCTAGTCAAACTCCTCAAAGG + Intronic
1002295348 5:178227689-178227711 TTCTCATTAAAACTCTTCAGTGG - Intronic
1003534470 6:6964204-6964226 TGCCCAGTAACAGACCTCAAGGG + Intergenic
1003572814 6:7267168-7267190 TGCCCAGAAATGCTCCTAAGTGG + Intergenic
1004005322 6:11632740-11632762 TGCCCAGGACAAGTCCTGAGTGG + Intergenic
1011676833 6:89742941-89742963 TGCACAGTAATACTTCTCATAGG - Intronic
1013443162 6:110192008-110192030 TGCCCTGTAAAACTACTCTAGGG + Intronic
1016207355 6:141485558-141485580 TGGCCAATAAAACTGCTGAGAGG + Intergenic
1017570159 6:155735501-155735523 TGCCCAGGAAGATTTCTCAGTGG - Intergenic
1018192766 6:161325119-161325141 TGCCCAGTACATCTTCCCAGAGG + Intergenic
1018973135 6:168542900-168542922 TGCCCAGTAAAACTCCTCAGGGG - Intronic
1019062961 6:169270027-169270049 TGGAAAGTAAAACTCATCAGAGG - Intergenic
1020974310 7:14986321-14986343 TGTCAAATAAAACTCCTTAGGGG + Intergenic
1022595496 7:31709736-31709758 TGGCCAGAAAAAGTCCTCAGGGG - Intergenic
1023491273 7:40744733-40744755 TGCTCAGCAAAACTCCTTAAGGG - Intronic
1026925585 7:74190590-74190612 AGCCCAGGGAAACTCCTCTGTGG + Intronic
1031167159 7:118243092-118243114 TGCCTAGGACAACTCCTCATGGG + Intergenic
1032345573 7:131113478-131113500 TGCCCCTTAAAATTCATCAGTGG - Intronic
1032518647 7:132525856-132525878 AGCTCACTAAAAGTCCTCAGAGG + Intronic
1035560743 8:601927-601949 TTCCTAGTAAACCTCCTCATTGG - Intergenic
1039002884 8:33001224-33001246 TTCCCAGTAAATTTTCTCAGAGG + Intergenic
1039270903 8:35879114-35879136 TTCACAGTAAGACTCCTCAAAGG + Intergenic
1041945172 8:63432846-63432868 AGCCCAGTAAATCTCCTGAGAGG - Intergenic
1043136713 8:76536394-76536416 TGCCCTGCAAAACCTCTCAGTGG + Intergenic
1044326947 8:90869379-90869401 TACACAGTGAAACTCGTCAGTGG - Intronic
1048225596 8:132582125-132582147 TGCCCATTAAAGCTGCTCACAGG - Intronic
1048258700 8:132926385-132926407 TGCCCCTTAAATCTCTTCAGTGG + Intronic
1049337735 8:142095559-142095581 TCCCCAGTAAGGTTCCTCAGTGG - Intergenic
1049930809 9:454884-454906 TGCCCAGTAAAACTAGTCCCAGG + Intronic
1050197269 9:3099345-3099367 TGTCCAGTACAATTTCTCAGGGG + Intergenic
1051246704 9:15119057-15119079 AGCCCAGGAAAACTCCTAATAGG + Intergenic
1051855861 9:21564464-21564486 TGCTCAGTAAGACTCCATAGAGG + Intergenic
1052432399 9:28383505-28383527 TGGGCAGTCAAACTCCTCAGGGG + Intronic
1056544734 9:87604232-87604254 TGCCAAGTAAGACCCTTCAGAGG - Intronic
1058870585 9:109198374-109198396 AGCCCCACAAAACTCCTCAGAGG + Intronic
1062396821 9:136355921-136355943 TGCCCCCGAAAACTCCTCACTGG - Intronic
1185518618 X:719709-719731 TGGCCAGTAAAACTCGTAAGTGG - Intergenic
1186333313 X:8559740-8559762 TGCCCATGAAAACTTCTCAGAGG + Intronic
1186718513 X:12278536-12278558 TACCTAAAAAAACTCCTCAGTGG + Intronic
1191667676 X:63720059-63720081 TGCTCAGAAAAAAACCTCAGAGG + Intronic
1193326045 X:80179604-80179626 TGCCCATTTAATTTCCTCAGGGG - Intergenic
1193743200 X:85243744-85243766 TTCCCACAGAAACTCCTCAGGGG + Intergenic
1196720314 X:118847689-118847711 TTCACAGGAAAAATCCTCAGTGG - Intergenic
1198221087 X:134603193-134603215 TCCCCAGTCCCACTCCTCAGAGG - Intronic
1199335627 X:146616131-146616153 TGCTCAATAAAACTTCGCAGTGG - Intergenic
1200229259 X:154436038-154436060 AGCCCAAGAAAGCTCCTCAGCGG - Exonic
1201343444 Y:12957831-12957853 TGCCCATTTAATTTCCTCAGGGG - Intergenic
1201955620 Y:19619256-19619278 TGCCCATTTAAATTCCTCAGGGG - Intergenic