ID: 1018977228

View in Genome Browser
Species Human (GRCh38)
Location 6:168574743-168574765
Sequence GTGCCGGTCTTCAGGGAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018977228_1018977235 9 Left 1018977228 6:168574743-168574765 CCGACCTCCCTGAAGACCGGCAC 0: 1
1: 0
2: 2
3: 11
4: 173
Right 1018977235 6:168574775-168574797 TGGTCTCACTTCAGACAGCCAGG No data
1018977228_1018977236 12 Left 1018977228 6:168574743-168574765 CCGACCTCCCTGAAGACCGGCAC 0: 1
1: 0
2: 2
3: 11
4: 173
Right 1018977236 6:168574778-168574800 TCTCACTTCAGACAGCCAGGAGG No data
1018977228_1018977237 13 Left 1018977228 6:168574743-168574765 CCGACCTCCCTGAAGACCGGCAC 0: 1
1: 0
2: 2
3: 11
4: 173
Right 1018977237 6:168574779-168574801 CTCACTTCAGACAGCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018977228 Original CRISPR GTGCCGGTCTTCAGGGAGGT CGG (reversed) Intronic
900974215 1:6007232-6007254 GTGCCAGGCTCCAGAGAGGTGGG + Intronic
903421055 1:23217783-23217805 GTAGGGGTCTGCAGGGAGGTGGG + Intergenic
904192256 1:28754685-28754707 GTGCCTGTATTCAGGGGGCTGGG + Intronic
904491049 1:30859257-30859279 GTGGCAGTCTGCAGGGAGGTAGG - Intergenic
905257416 1:36693745-36693767 GGGCTGGTTTCCAGGGAGGTGGG + Intergenic
908175134 1:61547753-61547775 ATGCAGGTTTTCAGGGAAGTGGG + Intergenic
912711086 1:111950434-111950456 GTGCCGGTCCTCAGGGAGTGAGG - Intronic
913184698 1:116359552-116359574 GTGATGGTCTTCAGGGTGGTGGG - Intergenic
913565444 1:120069020-120069042 GTGCCAGGGTGCAGGGAGGTGGG - Intronic
913632688 1:120724542-120724564 GTGCCAGGGTGCAGGGAGGTGGG + Intergenic
914286033 1:146228375-146228397 GTGCCAGGGTGCAGGGAGGTGGG - Intronic
914346047 1:146799366-146799388 GTGCAGGTTGTCAGGGAAGTGGG - Intergenic
914547064 1:148679128-148679150 GTGCCAGGGTGCAGGGAGGTGGG - Intronic
914619443 1:149391234-149391256 GTGCCAGGGTGCAGGGAGGTGGG + Intergenic
914900622 1:151709338-151709360 CTTCCGGTCTTCTGGGTGGTAGG + Exonic
915103163 1:153515163-153515185 GTGCCGGCCTCCAGGCAGGGTGG + Intergenic
915551602 1:156638500-156638522 GGGCAGGTGTTCAAGGAGGTTGG + Intergenic
919277892 1:195444891-195444913 ATGCCGGTTGTCAGGGAAGTGGG - Intergenic
919837503 1:201585137-201585159 GTGCCTGACTTCAGGGATGAGGG - Intergenic
920756724 1:208739986-208740008 GTGGCGCTCCTCAGGGAGGCTGG - Intergenic
922215944 1:223520087-223520109 GCTCTGGTCTTCTGGGAGGTGGG - Intergenic
922978196 1:229802536-229802558 GAGCTGGTTTTCAAGGAGGTAGG - Intergenic
924321433 1:242854910-242854932 ATGCAGGTCATCAGGGAAGTAGG + Intergenic
924946731 1:248851518-248851540 GGTGCGGTCTTCAGAGAGGTGGG - Intronic
1069821360 10:71230599-71230621 GTGCCAGGCTCCAGGGATGTGGG - Intronic
1069881578 10:71596895-71596917 GTGCCGGGCAGCGGGGAGGTGGG - Intronic
1071870573 10:89789762-89789784 ATGCAGGTCTCCAGGGAAGTGGG + Intergenic
1071932155 10:90484662-90484684 ATGCAGGTCTCCAGGGAAGTGGG + Intergenic
1072827813 10:98626192-98626214 GTGGCGGTAGTCATGGAGGTGGG + Intronic
1075926726 10:126257091-126257113 GTGTCAGTGTTCAGGGAGGAAGG - Intronic
1076175525 10:128364926-128364948 GTGCTGCAATTCAGGGAGGTTGG + Intergenic
1076364645 10:129914191-129914213 GTGCAGGGCTGGAGGGAGGTGGG - Intronic
1077343515 11:2036347-2036369 GGGCCAGGCTACAGGGAGGTGGG + Intergenic
1077504072 11:2922171-2922193 GTGCTGGTCTTCATCGTGGTGGG + Exonic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083705189 11:64509264-64509286 GTGTAGGCCATCAGGGAGGTCGG - Intergenic
1089432431 11:118435674-118435696 GTGCCCTTCTGCAGGGAGTTGGG - Intergenic
1089523468 11:119081229-119081251 CTTCCGGTTTTCAGGGAGGCAGG - Exonic
1202826501 11_KI270721v1_random:91536-91558 GGGCCAGGCTACAGGGAGGTGGG + Intergenic
1091712245 12:2750265-2750287 CTGCTGGTCTCCATGGAGGTGGG + Intergenic
1096687765 12:53300073-53300095 ATGCTGGACTTCAGGGAGGCAGG - Intronic
1097178985 12:57160150-57160172 GTCCCTGTCTTCAGGGAAATGGG + Intronic
1103516281 12:121510257-121510279 GTGCCAGTGTTCAGAGAGGCGGG - Intronic
1104804689 12:131577982-131578004 GTGCCTGTGTTCAGGAGGGTGGG + Intergenic
1110181778 13:72626027-72626049 GTACAGGTCATCAGGGAAGTCGG - Intergenic
1111030677 13:82592912-82592934 GTGCAGGTTTTCTGGGAAGTGGG - Intergenic
1113195848 13:107804518-107804540 GTCCCTGTCTTCAGGGAGCTTGG - Intronic
1113960672 13:114124058-114124080 GTGCCGGGCTTCTGGGGGCTGGG - Intronic
1115976843 14:39005763-39005785 GTGCCTGACTTCAGGGATGAGGG - Intergenic
1117768458 14:59107728-59107750 GTGCAGGTTATCAGGGAAGTTGG - Intergenic
1118162304 14:63302309-63302331 TTGCCGGTTGTCAGGGAAGTGGG - Intergenic
1121238821 14:92413282-92413304 GGGCAGGTGTTCTGGGAGGTGGG - Intronic
1124602617 15:31147852-31147874 GTCCAGGTCCCCAGGGAGGTGGG + Intronic
1127691507 15:61401964-61401986 GTGCCTGTCCTCTGAGAGGTGGG + Intergenic
1128238711 15:66085059-66085081 GTGCAGGTTGTCAGGGAAGTGGG - Intronic
1128750538 15:70145689-70145711 CTGCCAGTCTTGAGGGATGTGGG + Intergenic
1128966323 15:72061764-72061786 GTGCTTCTCTTCAGGGAGATAGG - Intronic
1129036014 15:72648725-72648747 GGGCTGGTCTTCAGGGTGCTGGG + Intergenic
1129213871 15:74088491-74088513 GGGCTGGTCTTCAGGGTGCTGGG - Intergenic
1129400141 15:75276872-75276894 GGGCTGGTCTTCAGGGTGCTGGG + Intronic
1129731008 15:77932836-77932858 GGGCTGGTCTTCAGGGTGCTGGG - Intergenic
1131248304 15:90814690-90814712 GTGCCTGTCAGCAGGGAGCTGGG + Intronic
1132148242 15:99441267-99441289 GAGCCAGACTTCAGGGAGGCTGG - Intergenic
1132191122 15:99861788-99861810 GTGGCGGTGTGGAGGGAGGTGGG - Intergenic
1132605465 16:792034-792056 GTTCCCGTCTTGAGGGTGGTGGG + Intronic
1132686214 16:1163229-1163251 GTGCCCGTCTGCAGGGCAGTGGG + Intronic
1132719923 16:1310526-1310548 GTGCCTGTCTTTGGGGAGTTCGG + Intronic
1132897252 16:2234922-2234944 GTGCGGGTCTTCCGTGAGGACGG - Exonic
1138607070 16:58096429-58096451 GTGGCTGTCACCAGGGAGGTAGG - Intergenic
1138977463 16:62225149-62225171 GTGCCTGTCTTCAGGTAACTCGG - Intergenic
1139490684 16:67284440-67284462 TTTCAGCTCTTCAGGGAGGTGGG + Exonic
1139987932 16:70915901-70915923 GTGCAGGTTGTCAGGGAAGTGGG + Intronic
1141001208 16:80309922-80309944 GGGCAAGTCTTCAGAGAGGTAGG - Intergenic
1141611339 16:85182707-85182729 GTGCAGGTCTTCAGGGAGGCAGG + Intronic
1141839532 16:86565937-86565959 GTCCCGGTCTTCTGGGAGTGCGG + Intergenic
1143427155 17:6849120-6849142 TTGCTGGTCTCCAGGGGGGTGGG + Intergenic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145962608 17:28896458-28896480 TTTCTGGTCTTCAGGGGGGTAGG + Intronic
1146279477 17:31536017-31536039 GTGCTGGTGTTCAGGGGAGTTGG + Exonic
1146479702 17:33195172-33195194 CTGCCTGTGCTCAGGGAGGTTGG - Intronic
1146716123 17:35088799-35088821 CTGCCGGTCTGCAGGGCGCTTGG + Intronic
1146940652 17:36842295-36842317 GAGCCTGTCTTCAGGGAGTCTGG + Intergenic
1146968813 17:37055734-37055756 GTCCCTGTCATCAGGGAGGTGGG - Intronic
1151973421 17:77470871-77470893 GAGCAGCTCTTCTGGGAGGTGGG + Intronic
1152128804 17:78463752-78463774 GTGCCTGCGTTCAGGTAGGTGGG - Intronic
1152854087 17:82654012-82654034 GTGTTGGTCGTCGGGGAGGTGGG - Intergenic
1153065435 18:1039738-1039760 ATGCAGGTCATCAGGGAAGTAGG - Intergenic
1156893375 18:42215591-42215613 ATGCAGGTCTCCAGGGAAGTGGG + Intergenic
1157182196 18:45507634-45507656 GTAACTGTGTTCAGGGAGGTAGG + Intronic
1157313038 18:46566513-46566535 GTGCTGGTGTTTGGGGAGGTAGG - Intronic
1158517900 18:58146196-58146218 GTGCTGATCCTCAGGAAGGTGGG + Intronic
1162705043 19:12549412-12549434 TTCACTGTCTTCAGGGAGGTTGG - Intronic
1163641444 19:18464702-18464724 GTGCCGGGCTTCAGGGAGGAGGG - Intronic
1163700670 19:18785183-18785205 GTGCAGGTCTGCAGGCAGATCGG - Intronic
1165313438 19:35041532-35041554 GTGCCTGTCTGCGGGGATGTGGG - Intronic
1167157155 19:47745791-47745813 GGGCGGGACTTCCGGGAGGTGGG + Intronic
925952095 2:8924353-8924375 GTGCAGGTCTTTAGGAAGGAAGG - Intronic
926621293 2:15049200-15049222 GTGACTGGCTTCAGGGAGCTGGG - Intergenic
927257648 2:21054210-21054232 GGGCCGGTCCTCAGTGAGGCAGG - Intergenic
927968073 2:27284406-27284428 GTGCTGGTCTTCAGTGAAGGTGG - Intronic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932400779 2:71479654-71479676 GTGCCTGTCCCCAGTGAGGTGGG - Intronic
932412765 2:71557085-71557107 CTGCCAGGCTTCAGGAAGGTTGG - Intronic
932812231 2:74834869-74834891 GTGCCGGAGCTCAGGGAGGGAGG - Intronic
933779421 2:85791158-85791180 ATGCCTGGCTTCAGGGAGGCAGG - Intergenic
933876439 2:86624935-86624957 GTGTCAGTCTTGAGGGAGGAAGG + Intronic
934765885 2:96879787-96879809 GAGCTGGGCTTCAGAGAGGTTGG - Intronic
938080419 2:128367178-128367200 AGGCAGGTGTTCAGGGAGGTAGG - Intergenic
938725572 2:134105983-134106005 GTGCCATTCTTGAGTGAGGTGGG - Intergenic
940034730 2:149301820-149301842 GTGCAGGTTGTCAGGGAAGTAGG + Intergenic
940217512 2:151315736-151315758 ATGCCGGTTGTCAGGGAAGTGGG - Intergenic
944602102 2:201313445-201313467 GTGCAGGTTGTCAGGGAAGTAGG - Intronic
945261216 2:207844894-207844916 ATTCCGGCCTTCAAGGAGGTGGG + Intronic
946238844 2:218341752-218341774 GTGCCAGTCTTCAGATAGGCTGG - Intronic
946346470 2:219115065-219115087 GACCCGGTCTTCTAGGAGGTTGG + Intronic
946361794 2:219223393-219223415 GTGCCTTTCTTAAGGGAGCTTGG + Intronic
946433669 2:219638596-219638618 GTCCAGGACTTCAGGGAGCTGGG - Intronic
1171160323 20:22916506-22916528 GTGCAGGTTGTCAGGGAAGTTGG + Intergenic
1173255763 20:41393414-41393436 GTGCTGGGTTTCAGGGAGTTGGG + Intergenic
1175733063 20:61367116-61367138 GTGCAGGTCCTCAGGGAGGAGGG + Intronic
1176106914 20:63393766-63393788 GTGCCAGCCCTCAGGGAGGACGG + Intergenic
1176196809 20:63840713-63840735 GTGCCCCTCTGGAGGGAGGTGGG + Intergenic
1178732848 21:35120642-35120664 GTGCAGGTCACCAGGGAAGTGGG - Intronic
1179166927 21:38942674-38942696 GTGCTGTGCTCCAGGGAGGTTGG + Intergenic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1180075307 21:45458874-45458896 GTGCCGGTCTCCTGGGAGTTGGG + Intronic
1180260265 21:46663589-46663611 GTGCCGGTCCTCAGGGAGACAGG + Intronic
1181558994 22:23688839-23688861 GTGCCGGTCTGCGGTGAGATTGG + Intronic
1182521873 22:30889397-30889419 GTGCCAGTCCTCAGGGTGGAGGG + Intronic
1183258826 22:36781050-36781072 ATGCTGCTCTTCAGGGATGTCGG - Intergenic
1184545349 22:45163847-45163869 GCGCCGGTTTCCAGGGAGCTGGG + Exonic
950817539 3:15722137-15722159 GCCCCTGGCTTCAGGGAGGTAGG + Intronic
954553284 3:51499714-51499736 GGGCCGGTCTGCCGGGAGGCTGG - Intronic
957560124 3:81812060-81812082 GTGGCGCTCGTCAGGGAGGCTGG + Intergenic
963851903 3:150217649-150217671 GTGCAGGTGTTTGGGGAGGTGGG + Intergenic
964248648 3:154684485-154684507 GTGCAGGTCACCAGGGAAGTAGG + Intergenic
966122396 3:176536965-176536987 ATGCAGGTTTTCAGGGAAGTTGG - Intergenic
966878794 3:184338269-184338291 GCGCTGGTCTTCTGGAAGGTGGG + Intronic
967884565 3:194324267-194324289 GAGCCGGTCTTGAGAGGGGTGGG - Intergenic
968665454 4:1819333-1819355 GTGCAGGACTACAGCGAGGTGGG - Exonic
968936576 4:3614246-3614268 GAGCTGGGCTGCAGGGAGGTGGG - Intergenic
968970249 4:3789882-3789904 GTGCCGGCCTCCAGGGATGAGGG - Intergenic
983035867 4:162865041-162865063 ATGCAGGTCTCCAGGGAAGTGGG - Intergenic
984503253 4:180583679-180583701 GTGCCTGTCTTCAGGATGTTTGG - Intergenic
994568390 5:101483021-101483043 ATGCAGGTTTTCAGGGAAGTGGG + Intergenic
994875290 5:105413881-105413903 ATGCAGGTTTTCAGGGAAGTAGG - Intergenic
998402336 5:141854219-141854241 GTTCCGGTCTTCCGGGGGGCTGG + Exonic
999271708 5:150300487-150300509 GGGCCGGTCTTCATAGAGGTGGG + Intronic
1001951119 5:175817354-175817376 GCGCAGTTGTTCAGGGAGGTAGG - Intronic
1002581789 5:180213050-180213072 GTGCGGGTCCTCAGGGAGGAAGG + Intergenic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1003029449 6:2589330-2589352 ATGCAGGTTGTCAGGGAGGTGGG + Intergenic
1003153128 6:3569889-3569911 GAGCCAGAATTCAGGGAGGTGGG - Intergenic
1004280802 6:14278111-14278133 GTGGCAGGCTTCAGGGTGGTAGG + Intergenic
1013317675 6:108957632-108957654 GTGCAGGGCTAGAGGGAGGTAGG - Intronic
1015535869 6:134267117-134267139 GTGCGGGTGTTCAGGGAGTCAGG - Intronic
1018780507 6:167059720-167059742 GTTCCTGTCTTCATGGAGTTGGG + Intergenic
1018977228 6:168574743-168574765 GTGCCGGTCTTCAGGGAGGTCGG - Intronic
1020030958 7:4932293-4932315 GCTCGGGTCTTCAGGGTGGTGGG - Intronic
1021486632 7:21175331-21175353 GTGTGGGTCTTGAGAGAGGTGGG - Intergenic
1022941854 7:35249369-35249391 CTGCAGGGCTGCAGGGAGGTTGG - Intronic
1023963674 7:44949421-44949443 GTGACGGTTTTCAGAGAGATTGG + Intergenic
1024471849 7:49774127-49774149 GCGCCGGTCTTCAGGGCTGAGGG + Intronic
1028075858 7:86514618-86514640 GTAGCTGTCTCCAGGGAGGTGGG + Intergenic
1028900545 7:96095081-96095103 GTGACTTTCTTCATGGAGGTGGG - Intronic
1030703337 7:112665895-112665917 GTGGCAGTCTTCAGGGAAGCTGG - Intergenic
1031412484 7:121456699-121456721 GTCTCTGTCTTCAGGGAAGTGGG + Intergenic
1031675772 7:124610292-124610314 GTGCAGGTCACCAGGGAAGTGGG - Intergenic
1034587506 7:152108104-152108126 GTGCCGGTCCTCACGGATGGCGG - Exonic
1037281850 8:17250056-17250078 GTGAGGGTCTTCAGGGCGGAAGG + Intronic
1037632311 8:20669417-20669439 GGGCCTGTCTTCAGGGAGGGGGG - Intergenic
1037857708 8:22383630-22383652 GTGCTGGCCTGCAGGGAGGCTGG + Intronic
1040711548 8:50195199-50195221 ATGCAGGTCATCAGGGAAGTGGG + Intronic
1052773144 9:32707770-32707792 GTGACTGTCTTCAAGGAGCTTGG + Intergenic
1055012422 9:71581256-71581278 GTAACGCTCTTCAGGGAGCTGGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1057253720 9:93525838-93525860 TTCCCGGTCTTCATGGAGCTTGG - Intronic
1059138350 9:111828984-111829006 GGGCCAGCCTTCAGGGAAGTTGG - Intergenic
1059250072 9:112880429-112880451 GTGAGGGTCTTCAGGCTGGTTGG - Intronic
1060902055 9:127267581-127267603 GTGCTGGTGGTCAGGAAGGTTGG + Intronic
1062345939 9:136115344-136115366 ATGCCTGTGTTCAGGGAGGGTGG - Exonic
1189218148 X:39344938-39344960 GTGCAGGTTGTCAGGGAAGTGGG - Intergenic
1191080346 X:56504216-56504238 ATGCAGGTTTTCAGGGAAGTGGG - Intergenic
1199769399 X:150964793-150964815 TTGCCGGTGTTCAGGGATGAAGG - Intergenic
1200079091 X:153566711-153566733 GTGCAGGTGTGCAGGAAGGTTGG - Intronic
1200511617 Y:4085864-4085886 ATGCAGGTTTTCAGGGAAGTTGG - Intergenic
1201306681 Y:12556553-12556575 ATGCAGGTCATCAGGGAAGTGGG - Intergenic