ID: 1018977804

View in Genome Browser
Species Human (GRCh38)
Location 6:168578772-168578794
Sequence TATTATGAAGAATTGGACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018977799_1018977804 21 Left 1018977799 6:168578728-168578750 CCTCATGTCATGAATTTGCTGAG 0: 1
1: 0
2: 1
3: 15
4: 149
Right 1018977804 6:168578772-168578794 TATTATGAAGAATTGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018977804 Original CRISPR TATTATGAAGAATTGGACGT GGG Intronic
No off target data available for this crispr