ID: 1018978197

View in Genome Browser
Species Human (GRCh38)
Location 6:168581772-168581794
Sequence GGGGCTGCAGGGAGGCAGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1324
Summary {0: 1, 1: 2, 2: 12, 3: 163, 4: 1146}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018978197_1018978219 16 Left 1018978197 6:168581772-168581794 CCCCGCTGCCTCCCTGCAGCCCC 0: 1
1: 2
2: 12
3: 163
4: 1146
Right 1018978219 6:168581811-168581833 CATTGACCGGGGCTGGGTGCAGG No data
1018978197_1018978216 9 Left 1018978197 6:168581772-168581794 CCCCGCTGCCTCCCTGCAGCCCC 0: 1
1: 2
2: 12
3: 163
4: 1146
Right 1018978216 6:168581804-168581826 CCTTCCTCATTGACCGGGGCTGG 0: 1
1: 0
2: 0
3: 13
4: 194
1018978197_1018978209 3 Left 1018978197 6:168581772-168581794 CCCCGCTGCCTCCCTGCAGCCCC 0: 1
1: 2
2: 12
3: 163
4: 1146
Right 1018978209 6:168581798-168581820 CCCCTCCCTTCCTCATTGACCGG No data
1018978197_1018978213 5 Left 1018978197 6:168581772-168581794 CCCCGCTGCCTCCCTGCAGCCCC 0: 1
1: 2
2: 12
3: 163
4: 1146
Right 1018978213 6:168581800-168581822 CCTCCCTTCCTCATTGACCGGGG 0: 1
1: 0
2: 0
3: 7
4: 165
1018978197_1018978211 4 Left 1018978197 6:168581772-168581794 CCCCGCTGCCTCCCTGCAGCCCC 0: 1
1: 2
2: 12
3: 163
4: 1146
Right 1018978211 6:168581799-168581821 CCCTCCCTTCCTCATTGACCGGG 0: 1
1: 1
2: 2
3: 22
4: 275
1018978197_1018978217 10 Left 1018978197 6:168581772-168581794 CCCCGCTGCCTCCCTGCAGCCCC 0: 1
1: 2
2: 12
3: 163
4: 1146
Right 1018978217 6:168581805-168581827 CTTCCTCATTGACCGGGGCTGGG 0: 1
1: 0
2: 1
3: 9
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018978197 Original CRISPR GGGGCTGCAGGGAGGCAGCG GGG (reversed) Intronic
900003523 1:29228-29250 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
900014163 1:137360-137382 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900023243 1:199744-199766 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
900044026 1:492562-492584 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900065436 1:727468-727490 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
900087403 1:904996-905018 GGGGGTGCGGGAAGGCTGCGGGG + Intergenic
900109260 1:998730-998752 GGGGCTGCAGGGATGCGGAGGGG + Intergenic
900153946 1:1196581-1196603 GCTTCTGCAGGGAGGCAGGGAGG - Exonic
900153995 1:1196825-1196847 AGGGCTGCATGCAGGCAGGGTGG - Intronic
900494877 1:2971850-2971872 GGCCTTGCCGGGAGGCAGCGAGG + Intergenic
900534684 1:3170994-3171016 GGGACTGCAGCGAGGCTGTGTGG - Intronic
900601882 1:3506229-3506251 GGGGCAGCCTGGGGGCAGCGGGG + Exonic
900619786 1:3581433-3581455 GGGGCTGCAGGGAAGCCGGATGG + Intronic
900622915 1:3595628-3595650 GGGGCAGCATGGAGGCAGCAGGG + Intronic
900636531 1:3668890-3668912 GGGGGAGCAGGGATGCAGGGTGG + Intronic
900764420 1:4494502-4494524 GGGGCTGCAGGGGGCCTGCGTGG - Intergenic
900970850 1:5991906-5991928 GGGGCTGCAGAGAGGCCAGGGGG + Intronic
900987149 1:6079703-6079725 GGGGCTGGAGGCAGGGAGCGGGG + Intronic
901253109 1:7796675-7796697 GGGGAAGAAGGGAGGCAGGGAGG + Intronic
901323237 1:8351871-8351893 GGGGCTGCAGGCAGCCTGCAGGG - Intergenic
901352323 1:8608437-8608459 GGGGCTGCAGTGAGCCAGAATGG + Intronic
901405990 1:9046145-9046167 GTGACTGGAGGGAGGCAGTGAGG + Intronic
901436175 1:9248657-9248679 GGTGTTGCAGGCAGGCAGCGTGG + Intronic
901577315 1:10210976-10210998 GGGTCTGAGGGGAGGTAGCGCGG + Intronic
901631246 1:10649226-10649248 GGGGCTCCAGGGCGGGTGCGGGG + Intronic
901637746 1:10678188-10678210 CGGGCTGCAGGGAGGGCGGGTGG - Intronic
901703775 1:11059240-11059262 GTGGCTGCAGAGAGGCAGGTTGG + Exonic
901737645 1:11322492-11322514 GGGGCTGCGGGGAGGGATCAGGG - Intergenic
901799861 1:11701729-11701751 CGGGCTGCGGGGAGGCGGAGGGG + Intronic
901802887 1:11719444-11719466 GGGGCTGCCGTGAGGAAGCTGGG + Intronic
902072230 1:13749652-13749674 GGGACCGCAGGGCGGGAGCGGGG - Intronic
902229984 1:15021697-15021719 GGGACTGCAGGGAGCCACAGGGG - Intronic
902333621 1:15742807-15742829 GGGGCGGGAGGGAGGCAGCGAGG - Intronic
902559009 1:17265398-17265420 AGGGCTGCAGGGATGCAGATAGG + Intronic
902566670 1:17315930-17315952 GGGTCATCAGGGAGGCAGCCAGG - Intronic
902574630 1:17369742-17369764 GGGTCTGGAGGAAGGCAGCCTGG - Intergenic
902620112 1:17645856-17645878 GAGGATGCAGTGAGGCAGTGTGG + Intronic
902711376 1:18242274-18242296 GGGCATGCAGGGAGGCAGCGTGG - Intronic
902723053 1:18316934-18316956 GGGGCTGCAAGTAGACAGAGTGG + Intronic
903032890 1:20476307-20476329 GCGGGGGCAGGGAGGCCGCGCGG + Intergenic
903186685 1:21633255-21633277 GAGGCTGGAGGGAGTCAGCAGGG - Intronic
903279969 1:22244828-22244850 GGTGCTGGGGGGAGGCAGCCGGG + Intergenic
903649422 1:24913845-24913867 GGGCCTGCATGGAGGCAAGGGGG - Intronic
903741757 1:25562529-25562551 GAAGCTGCAGGGAGGGAGCCAGG + Intronic
903762885 1:25711646-25711668 GGGGCCGCAGGGAGGAGGGGCGG - Intronic
903907214 1:26695957-26695979 GGGGAGGGAGGGAGGGAGCGGGG - Intergenic
903996356 1:27307510-27307532 GGGGAAGCAGGGAGGGAGAGAGG - Exonic
904028277 1:27518619-27518641 GGGGTTGGAGGGAGGGAGGGAGG + Intergenic
904472604 1:30745432-30745454 GGGGCTGAGGGGAGGGAGGGGGG - Intronic
904493291 1:30873183-30873205 GAGGCTGCAGGGAGGCACTGTGG + Exonic
904604522 1:31691442-31691464 GGGGGTCCAGGGAGGCCGGGGGG + Exonic
904782833 1:32963972-32963994 GGGGCAGCAGGGACCCCGCGTGG - Intronic
904836772 1:33342702-33342724 CTGGCTGCAGGGAGTCAGGGAGG + Intronic
904916844 1:33976480-33976502 GGTGCTCCAGGAAGGCAGAGAGG - Intronic
905101902 1:35531400-35531422 GGGGCTCCAGGGATGTAGAGAGG + Intronic
905106139 1:35564650-35564672 GGGGCTGCAGAGATGCAGCCTGG - Intronic
905275133 1:36812648-36812670 GGGTCTGCAGGGTGGGGGCGAGG + Intronic
905474097 1:38213792-38213814 CTGGCTGCAGGCAGGGAGCGAGG - Intergenic
905629306 1:39510091-39510113 GGGGCAGCAGGGAGGCGGCGTGG - Intronic
905668452 1:39776102-39776124 GGGGCAGCAGGGAGGCGGCGTGG + Intronic
905881499 1:41467195-41467217 GGGAGTGCAGGGAGGCTGCCTGG - Intergenic
905908666 1:41638912-41638934 GGGCTGGCAGGGAGGCAGGGGGG + Intronic
906201638 1:43964168-43964190 GAGCCTGCAGGGAGACAGCGTGG - Intronic
906212492 1:44019889-44019911 AGGGCTGCAGGGAGGCTGTGTGG + Intronic
906344161 1:45004810-45004832 GGGGTTGGAGAGAGGCAGGGAGG + Intronic
906610479 1:47198455-47198477 GAGGCTGGAGGGAGTCAGTGTGG + Intergenic
906733794 1:48105263-48105285 GGGCCTGCAGGGAGTGGGCGAGG - Intergenic
907319248 1:53592522-53592544 AGGGCTGCTGGGAGACAGCTGGG - Intronic
907372855 1:54014302-54014324 GGAGCAGCAGAGAGGCAGAGAGG + Exonic
907404711 1:54246905-54246927 GGTGCTGCAGGCAGGCAGGCAGG - Intronic
907439922 1:54472841-54472863 GGGGCTGGAGGAAGGCATAGGGG - Intergenic
907924752 1:58944749-58944771 GAAGCAGCAAGGAGGCAGCGTGG + Intergenic
908794377 1:67816636-67816658 GGGGCAGCAGTGAGCCAGAGGGG + Intronic
910884319 1:91949659-91949681 TGGGCTGCAGGCACGAAGCGGGG - Exonic
910884593 1:91951457-91951479 GGGGCGGCAGGGTGGCGGGGGGG + Intronic
911157957 1:94655162-94655184 GGAGCTGGAGGGACGCAGCCTGG - Intergenic
912795146 1:112688874-112688896 AGGGCTCGAGGGAGGCAGGGCGG - Intronic
912952926 1:114133034-114133056 GGGTATGCAGGGAGGAAGGGAGG - Intronic
913465623 1:119140085-119140107 GGGGCAGCAGGTTGGCAGTGTGG - Intronic
913655170 1:120953062-120953084 GGGGCGGTAGGGCGGGAGCGGGG + Intergenic
913673341 1:121118311-121118333 GGCGCTGCAGGAGGCCAGCGAGG - Intergenic
913962664 1:143352360-143352382 AGGTCTGCAGGAAGGCTGCGAGG - Intergenic
914006525 1:143736735-143736757 GGGGCCGTAGGGTGGGAGCGGGG + Intergenic
914057019 1:144177945-144177967 AGGTCTGCAGGAAGGCTGCGAGG - Intergenic
914122127 1:144788421-144788443 AGGTCTGCAGGAAGGCTGCGAGG + Intergenic
914200037 1:145476208-145476230 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914479155 1:148049343-148049365 GGGGCTGGAGGGCGGGAGCGGGG + Intergenic
914645355 1:149647222-149647244 GGGGCGGTAGGGCGGGAGCGGGG + Intergenic
914663555 1:149813387-149813409 GGCGCTGCAGGAGGCCAGCGAGG - Exonic
914667078 1:149840863-149840885 GGCGCTGCAGGAGGCCAGCGAGG - Exonic
914668689 1:149852927-149852949 GGCGCTGCAGGAGGCCAGCGAGG + Exonic
914827524 1:151146389-151146411 GGGGCTGCGGGGAGGCGGGGAGG - Intronic
915109286 1:153552911-153552933 GGGGCTTCAGGGAGGGCGGGAGG + Intergenic
915307531 1:154989270-154989292 GGGCCTGCAAGGAAGCAGCATGG + Intronic
915358133 1:155268841-155268863 GGGGCCGGAGGGAGGCGGGGTGG + Intronic
915515073 1:156407972-156407994 AAGGCTGCAGGGAGGGAGCAGGG + Exonic
915517183 1:156420456-156420478 GCGGCGGCCGGGAGGCTGCGTGG - Intronic
915669059 1:157472119-157472141 GGGACTGCAGAGAGGCAGAGAGG + Intergenic
916571796 1:166034409-166034431 AGGGCTGCAGGGAGGAAGCCTGG + Intergenic
916802232 1:168226176-168226198 GGGGACGCAGGGCGGGAGCGCGG - Intronic
916999306 1:170339021-170339043 GGGGATAAAGGGAGGCAGAGAGG + Intergenic
917859688 1:179134426-179134448 GAGGCTGCGTGGAGGCTGCGTGG + Intronic
918234229 1:182562702-182562724 GGGGCTCCAGGGAGGTTGTGAGG + Intergenic
918829693 1:189378539-189378561 GGGGGAGAAGGGAGGCAGTGTGG - Intergenic
919232856 1:194797707-194797729 GGGGCTGCAGGGAAGTAGATTGG + Intergenic
919512933 1:198488875-198488897 GGGTTTGCAGGGAGGGAGAGGGG + Intergenic
919787429 1:201268713-201268735 GCTGCTGCAGGGAGGGAGGGCGG + Intergenic
919880143 1:201895635-201895657 GGGGCTGCAGGCAGAGACCGTGG + Intergenic
920055444 1:203187452-203187474 GGTGCTGCAGTGAGGCACCATGG + Intergenic
920184287 1:204150937-204150959 GGGGCTGGAGGTAGTCAGCTGGG + Intronic
920284412 1:204869136-204869158 GGGGCTGGAGGGAGCCAGGGTGG + Intronic
920373670 1:205494887-205494909 GGGCTGGCAGGGAGGCAGTGGGG + Intergenic
920380315 1:205531301-205531323 GGGGCTGCAGGGAGGAGGCTGGG - Intronic
920441648 1:205984884-205984906 GGGGCTGGGAGGAGGCAGGGAGG - Intronic
920455379 1:206097234-206097256 AGGGCTGCAGGGAGGCAGGAGGG - Intronic
921005836 1:211093090-211093112 TGGGCTGCAGGGCTGCAGCTGGG - Intronic
921265454 1:213417561-213417583 GCGGCTGGAGGGAGGCAATGTGG + Intergenic
921555725 1:216596524-216596546 GGGAGTGCAGGGAGGGAGAGTGG + Intronic
921685306 1:218082982-218083004 GGGGCTGGTGGGAGTCAGTGGGG - Intergenic
921738259 1:218653448-218653470 GGGGCTGAAGCCAGGGAGCGAGG + Intergenic
921832555 1:219744472-219744494 GGGGCTGCAGTGAGCCATCATGG - Intronic
921921880 1:220678797-220678819 AGGGCTGCAGGGAAGCTGCCAGG - Intergenic
921945038 1:220880283-220880305 GGGGCTGCAGGGCGCCAGCCCGG - Exonic
922734427 1:227971722-227971744 CGGGCTGCCGGGAGGCAGGCAGG - Intergenic
922734494 1:227971965-227971987 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922734715 1:227972854-227972876 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
922734775 1:227973096-227973118 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
922775788 1:228213744-228213766 GCGGCTTCGGGGAGGTAGCGGGG + Intronic
922831804 1:228557920-228557942 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922832285 1:228609902-228609924 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922832845 1:228612143-228612165 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922833406 1:228614384-228614406 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922833966 1:228616625-228616647 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922834523 1:228618866-228618888 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922835634 1:228623301-228623323 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922836192 1:228625543-228625565 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922837309 1:228630024-228630046 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922837870 1:228632265-228632287 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922838428 1:228634505-228634527 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922840107 1:228641202-228641224 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922840667 1:228643443-228643465 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922841230 1:228645674-228645696 TGGGGGGAAGGGAGGCAGCGGGG + Intergenic
922963111 1:229664894-229664916 GAGGATGCAGAGAGCCAGCGGGG - Intergenic
923011256 1:230089568-230089590 GTGGCTGCAGGGAGGGAGAATGG - Intronic
923030500 1:230245843-230245865 TGGCCTGCTGGGAGGCAGGGAGG - Intronic
923501673 1:234570568-234570590 GGGCCTGCAGCCAGGCAGCTTGG - Intergenic
924261214 1:242233565-242233587 AGGGCGGCAGGGAGGGAGGGAGG + Intronic
924343490 1:243054935-243054957 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
924583738 1:245344076-245344098 AGGGAGGGAGGGAGGCAGCGAGG - Intronic
1062829066 10:593419-593441 GGGTCTGCTGGGAGACAGCGGGG - Intronic
1062882132 10:987885-987907 AGGGCTGCAGGGAAGCCGCGAGG + Intergenic
1062890543 10:1056685-1056707 GGGGCTGCGGGGCGGAAGCCGGG + Intronic
1062959968 10:1565506-1565528 GAGGCTGAGGGGAGGCAGCAGGG + Intronic
1063121821 10:3109895-3109917 GAGGGGGCAGGGAGGCAGGGAGG + Intronic
1063517288 10:6709497-6709519 GGGGCTGCGGGGAGGATGCCAGG + Intergenic
1064345971 10:14533170-14533192 CGGGCTGCAGGCAGGCAGGGCGG + Intronic
1065186286 10:23173682-23173704 GGGGCCGCGGAGAGCCAGCGTGG + Intergenic
1065207608 10:23372167-23372189 GGGGCTACAGGGAGGGAGCAAGG + Intergenic
1065526083 10:26622530-26622552 GCGGCTCCCGGGAGGCGGCGGGG - Intergenic
1065561421 10:26967948-26967970 GGGGTTGCAGGGAGGGGGCAAGG - Intergenic
1066732626 10:38449169-38449191 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1066733032 10:38450775-38450797 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1067080753 10:43211020-43211042 GGGGCTGCAAGGAACCAGAGGGG - Intronic
1067203378 10:44193993-44194015 GGGGCCACAAGGAGGCAGGGAGG + Intergenic
1067414112 10:46091089-46091111 TGGGCTGCAGGGAGTCAGAGGGG + Intergenic
1067439530 10:46300726-46300748 TGGGCTGCAGGGAGTCAGAGGGG - Intronic
1067524371 10:47029330-47029352 GGGGCTGCACAGAGGCTGTGGGG - Intergenic
1067555597 10:47267720-47267742 GGGGCAGGAGGGAGGCAGCAAGG - Intergenic
1067565064 10:47330545-47330567 GGGGATGCAGAGAGGCTGCCAGG + Intergenic
1067582069 10:47452300-47452322 GGAGATGCAGAGAGGCAGTGGGG - Intergenic
1067827719 10:49591490-49591512 TGGGCTGCTGCGAGGCAGTGAGG + Intergenic
1068005146 10:51384390-51384412 AGGGATGCAGGCAGGCAGAGTGG + Intronic
1069612191 10:69781589-69781611 GAGGCTGCAGGGAGGGAGGCAGG + Intergenic
1069719841 10:70542441-70542463 GGGGCTGCTGGGAGGGAGGATGG - Intronic
1069748641 10:70731949-70731971 GGGACTGGAGGGAGGCATTGTGG + Intronic
1069774454 10:70918630-70918652 GGGGCTGCAGGAACGGAGCCCGG + Intergenic
1069774464 10:70918661-70918683 GGGGCTGCAGGAACGGAGCCCGG + Intergenic
1069774474 10:70918692-70918714 GGGGCTGCAGGAACGGAGCCCGG + Intergenic
1069774484 10:70918723-70918745 GGGGCTGCAGGAACGGAGCCCGG + Intergenic
1069774494 10:70918754-70918776 GGGGCTGCAGGAACGGAGCCCGG + Intergenic
1069774504 10:70918785-70918807 GGGGCTGCAGGAACGGAGCCCGG + Intergenic
1069774514 10:70918816-70918838 GGGGCTGCAGGAATGGAGCCTGG + Intergenic
1069897288 10:71687598-71687620 GAGGCTGCAGGGAGGCAGGTGGG - Intronic
1069931969 10:71889080-71889102 AGGTCTGCTGGGACGCAGCGCGG + Intergenic
1070321118 10:75355467-75355489 GGGGCAGCAGGGAGGTATCGTGG - Intergenic
1070354375 10:75625497-75625519 GGGGTTGGAGGGAGTCAGGGTGG + Intronic
1070394599 10:76001098-76001120 GGGTCTCCAGGAAGGCAGGGTGG - Intronic
1070579733 10:77710462-77710484 GGGGCAGCAGGTAGGAAGGGCGG + Intergenic
1070647424 10:78211417-78211439 AGGCCTGCAGGGAGACAGAGAGG - Intergenic
1070752839 10:78974037-78974059 GGAGCTGGGAGGAGGCAGCGAGG - Intergenic
1070780059 10:79132446-79132468 TGGGCTGGAGTGAGGCAGCAGGG + Intronic
1070813652 10:79310709-79310731 GAGGCTGCAGGGGGACGGCGGGG - Intronic
1070916877 10:80160779-80160801 GGAGCTGCAGGGAGGCTGCTGGG - Intronic
1071296218 10:84222032-84222054 GGGGCTGCAGGGGTGCAGCTGGG + Exonic
1072317818 10:94220927-94220949 GAAGCTGGAGGGAGGCAGCACGG - Intronic
1072878718 10:99203280-99203302 AGGGCTGCAGGGAGCCATCTTGG - Intronic
1072915121 10:99533070-99533092 GCGGGGGCGGGGAGGCAGCGCGG - Exonic
1073053431 10:100684027-100684049 GGGGCTGCAGGGGGGAGGGGAGG + Intergenic
1074829972 10:117241278-117241300 GGGGAGGCAGGGAGGCAGGGAGG + Intronic
1075418356 10:122282283-122282305 GGGGATCGAGGGAGGAAGCGAGG + Intronic
1075521904 10:123148283-123148305 GGTGCAGCAGGCAGGCAGTGGGG - Exonic
1075553221 10:123409414-123409436 GGGGATGGAGGGAGCCAGCTAGG + Intergenic
1075554526 10:123420712-123420734 GGGAGTGCAGGGAGTCTGCGAGG + Intergenic
1075593078 10:123706760-123706782 GGAGATGCAGGGAGGCAAAGCGG - Intronic
1075787055 10:125057081-125057103 GGGGCAGGAGGGAGACAGCAAGG + Intronic
1075897399 10:126008944-126008966 GGGGTTGCAGGGGGGCTGCTGGG + Intronic
1076015950 10:127027806-127027828 GGGGCTGCAGGAGAGCAGCCTGG + Intronic
1076140839 10:128077598-128077620 GGGGCTGCAGGGAGGAGAGGGGG - Exonic
1076294346 10:129373011-129373033 GGGGATGCAGTGAGGCATCATGG + Intergenic
1076315106 10:129534286-129534308 GAGGCAGCAGGGAGGCTGCAGGG + Intronic
1076353705 10:129837364-129837386 GGGGTGGCAGGGAGGGAGGGAGG - Exonic
1076384119 10:130045011-130045033 GGGCCGGTAGGGAGGCATCGGGG - Intergenic
1076401822 10:130189930-130189952 GGGGCTGCAGGGACACCCCGGGG + Intergenic
1076402011 10:130190723-130190745 GCGGCTGCCGGGAAGCAGGGCGG + Intergenic
1076540033 10:131207928-131207950 GCGGCTTCAGGGAGGCAGGCAGG + Intronic
1076692637 10:132231515-132231537 GGGTCTCCAGGGAGGCACCATGG - Intronic
1076778085 10:132709257-132709279 GGGGATGGAGGGAGGGAGGGGGG + Intronic
1076898445 10:133325483-133325505 GGGGCTGCAGCGAGGGCGCCTGG + Exonic
1076948247 10:133665803-133665825 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076948250 10:133665811-133665833 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076949236 10:133669113-133669135 AGGGAGGCAGGGAGGCAGGGAGG + Intronic
1076949239 10:133669121-133669143 AGGGAGGCAGGGAGGCAGGGAGG + Intronic
1076950220 10:133672412-133672434 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076950223 10:133672420-133672442 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076951205 10:133675711-133675733 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076951208 10:133675719-133675741 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076952195 10:133679021-133679043 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076952198 10:133679029-133679051 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076953183 10:133682331-133682353 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076953186 10:133682339-133682361 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076955151 10:133741982-133742004 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076955154 10:133741990-133742012 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076956141 10:133745292-133745314 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076956144 10:133745300-133745322 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076957129 10:133748601-133748623 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076957132 10:133748609-133748631 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076958118 10:133751911-133751933 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076958121 10:133751919-133751941 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076959102 10:133755210-133755232 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076959105 10:133755218-133755240 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076960091 10:133758520-133758542 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076960094 10:133758528-133758550 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1076970363 11:129037-129059 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1077009713 11:374677-374699 GGGGCCTCAGGGAGGGAGGGAGG + Intronic
1077109675 11:856560-856582 GGGGCAGCAGTGAGGGAGGGAGG + Intronic
1077297962 11:1834847-1834869 GGGGCTGCTGGGAGGTGGCTGGG + Intronic
1077375998 11:2205378-2205400 TGGGCTGCTGGGAGGTAGGGAGG - Intergenic
1077431967 11:2520215-2520237 GGGGCTTCTGGGGGGCAGCCTGG + Intronic
1077499414 11:2902482-2902504 CGGGATGCAGGGAGGCTGGGGGG - Exonic
1077537309 11:3130550-3130572 GGGGCTCCAAGGATGCAGCCAGG + Intronic
1078045135 11:7906682-7906704 GGGGGTGCGGGGAGGCAGCCAGG + Intergenic
1078129076 11:8596971-8596993 GGGGAGGGAGGGAGGCAGAGAGG + Intergenic
1078164571 11:8871085-8871107 CGGGCTGCAGGGAGAGAGAGGGG + Intronic
1078316994 11:10302748-10302770 AGGGCAGCGAGGAGGCAGCGAGG + Intergenic
1078455066 11:11468590-11468612 GGGGCTGCAGGGAGGTTGCTGGG + Intronic
1079082985 11:17427151-17427173 TGGCCTGCAGGGAGGGAGGGTGG + Exonic
1079452264 11:20607187-20607209 GGGGCTGCATGGTGCCAGAGGGG - Intronic
1079714690 11:23730777-23730799 GAAGCTGGAGAGAGGCAGCGAGG + Intergenic
1080503624 11:32892718-32892740 GGGGCTGGCGGGCGGCCGCGAGG - Intergenic
1080540076 11:33257239-33257261 GGGGCTTCACGGAGGCGCCGCGG + Intronic
1080831080 11:35893962-35893984 AGGGGAGCAGGGAGGCAGCTGGG - Intergenic
1081702050 11:45158365-45158387 GGAGCTGCAGGGAGGGAGGCAGG - Intronic
1082870778 11:57942604-57942626 GGGGCTGCAGGGAGGGAGCAGGG - Intergenic
1082935921 11:58656588-58656610 GGGGCTGGAGGGAGGGAATGCGG - Intronic
1083221997 11:61258713-61258735 GGGGCTGCTGGGGGCCAGGGTGG + Exonic
1083248180 11:61446455-61446477 GGAGCTGCAGGGAGGGCGGGAGG - Exonic
1083262618 11:61531384-61531406 GGCTGTGCAGGGAGGCAGGGTGG + Intronic
1083308921 11:61774804-61774826 GGGGCGAGAGGGAGGCAGGGAGG - Intronic
1083412981 11:62506506-62506528 GGGGCTGCAGGGAGGAATTTTGG - Intronic
1083428563 11:62602015-62602037 GGAGCTGCAGGGCTCCAGCGAGG - Intergenic
1083695949 11:64442529-64442551 GGGGCAGCAGTAAGGGAGCGAGG - Intergenic
1083719700 11:64598212-64598234 GGGTCTGGAGGGAGGCAGGAAGG + Intronic
1083722416 11:64609923-64609945 GGGGCTGCAGTGGGGCAGGCGGG - Intronic
1083890682 11:65594297-65594319 AGGGCTGCAAAGAGGCAGCATGG + Intronic
1084062911 11:66687518-66687540 GAGGCGGCAGGGTGGCAGCATGG + Exonic
1084155884 11:67312268-67312290 GGAGGTGCAGGGAGGGGGCGGGG - Exonic
1084269466 11:68021328-68021350 TGGGCTGCAGGGTGGCAGTGAGG + Intronic
1084547042 11:69819657-69819679 GCGGCGGCAGGGAGGCTCCGGGG + Intergenic
1084569284 11:69949747-69949769 AGGGCTGGAAGGAGGCAGGGAGG + Intergenic
1084680342 11:70663000-70663022 GGGAAGGGAGGGAGGCAGCGTGG + Intronic
1084694853 11:70746976-70746998 GGGGGTGCAGGGATGGAGGGAGG - Intronic
1084703742 11:70804062-70804084 TGGGCAGCAGGCAGGCAGGGTGG - Intronic
1084779464 11:71398935-71398957 GGAGCATCAGGGAGACAGCGTGG + Intergenic
1084786928 11:71448103-71448125 GGGGCTCCGGGGAGGCGGGGCGG - Intronic
1084872509 11:72107826-72107848 GGAGCTGCAGTGAGGCAGGTAGG + Intronic
1084891455 11:72238971-72238993 GGGGATGCACGGCGGCAGGGTGG + Exonic
1085027037 11:73242466-73242488 AGGGCTGCAGGTGGGCAGCCAGG + Intergenic
1085299738 11:75450975-75450997 ACGGCTCCAGGGAGGCAGGGCGG - Intronic
1085527666 11:77173629-77173651 AGGCCTGCAGGGAGGCACAGGGG + Intronic
1085707035 11:78795774-78795796 AGGGAGGCAGGGAGACAGCGTGG - Intronic
1085781033 11:79409455-79409477 GGGGCGGCAGGAATCCAGCGTGG + Intronic
1087083676 11:94196242-94196264 GGGGCTGCAGGAAGAAAGAGGGG - Intergenic
1087542744 11:99541882-99541904 GGGGCTGCAGGGCTACAGTGAGG + Intronic
1088500628 11:110478843-110478865 GGGACTGCCTGGAGGCACCGAGG + Intergenic
1089253059 11:117179044-117179066 GGGGCGGCCGGGAGGGGGCGGGG - Exonic
1089286981 11:117413775-117413797 GGGGGTGCAGGGATGGAGTGTGG - Intergenic
1089295476 11:117464801-117464823 GGGGATGCAGGGAGCCTGCGTGG + Intronic
1089309028 11:117545699-117545721 GGAGCTGAGGGGAGGCAGGGAGG + Intronic
1089466575 11:118689881-118689903 GGGGCTGCTGGGAGGCAGAGCGG - Intergenic
1089522816 11:119076963-119076985 GGGTCTGCAGGTAGGCAGTCAGG - Exonic
1089775572 11:120833084-120833106 GGGGCAGCTGGGAGGGAGGGAGG - Intronic
1089935412 11:122359360-122359382 GGGACTGGAGGGAGGGAGGGAGG - Intergenic
1090357071 11:126147236-126147258 GGGGCAGTAGGGAGGGAGGGAGG - Intergenic
1090437803 11:126701423-126701445 GGGACAGCAGGGAGGAAGCTGGG + Intronic
1090665810 11:128914334-128914356 GGGGGTGCAGCGGGGCAGCGGGG - Intronic
1090797691 11:130149245-130149267 GAGGCTGCAGTGAGCCAGCCTGG - Intergenic
1090966354 11:131600715-131600737 TGGGCTGCAGGAAGGCAGAATGG + Intronic
1091335493 11:134762798-134762820 GGGGCTGCAGGGAGAAAGGAGGG + Intergenic
1091376942 12:31282-31304 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
1091582196 12:1796847-1796869 GGGGAGGCAGGGAGGCCGCGCGG - Intronic
1091593937 12:1862476-1862498 GAGGCTGCAGTGAGACAGCCTGG - Intronic
1091756332 12:3054710-3054732 AGGGAGGCAGGGAGGCAGAGAGG - Intergenic
1091756333 12:3054718-3054740 AGGGAGGCAGGGAGGCAGGGAGG - Intergenic
1091786963 12:3248942-3248964 GGGGCCTCAGGGAGGCGGCATGG - Intronic
1092166986 12:6348370-6348392 GGGGCTGCTGAGAGGCTGAGAGG - Intronic
1092529383 12:9331887-9331909 GTGGCTGCAGGGAGGCTGGGGGG + Intergenic
1092894579 12:13000199-13000221 AGGGCGGCAGGGCGGCAGGGCGG + Exonic
1092894582 12:13000207-13000229 AGGGCGGCAGGGCGGCAGGGCGG + Exonic
1092894585 12:13000215-13000237 AGGGCGGCAGGGCGGCAGGGTGG + Exonic
1092894588 12:13000223-13000245 AGGGCGGCAGGGTGGCAGGGCGG + Exonic
1093005052 12:14042496-14042518 GTGTCTGCATGGACGCAGCGGGG + Intergenic
1093199340 12:16168364-16168386 GGGGGTAGAGAGAGGCAGCGAGG + Intergenic
1094199119 12:27779789-27779811 GGGGCTGCAGTGATGCTCCGGGG - Intergenic
1094414372 12:30201786-30201808 GGAGAGGCAGGGAGGCAGAGAGG - Intergenic
1095825798 12:46530340-46530362 GTGGCTGCAGGGAGGGCACGGGG + Intergenic
1096405818 12:51343601-51343623 GGGCCTGCAGGGAGGTAGTATGG - Intronic
1096429718 12:51532739-51532761 GGGGTTGGAGGGAGGCAGGAGGG + Intergenic
1096496929 12:52044001-52044023 TGGGCTGCGGGGAGGAAGCAAGG + Intronic
1096741288 12:53695766-53695788 GGGGCTGCAGGGAGACAGGTGGG + Intergenic
1096843669 12:54393572-54393594 GGGGGTGCAGGGAGGGGGAGGGG - Intergenic
1096864577 12:54554674-54554696 AGGGAAGCAGGGAGGCAGAGTGG + Intronic
1098450114 12:70610071-70610093 GGGGCTGGGGCGAGGCAGCGCGG - Intronic
1098568972 12:71968035-71968057 GGGGCTGCGAGGAGGGAGGGAGG + Intronic
1099147127 12:79060476-79060498 GGGGCTGCAGGGAGGGGGAATGG - Intronic
1101952415 12:109187062-109187084 GGGGATGGAGGGAGGGAGGGAGG + Intronic
1102044146 12:109819249-109819271 GGGGATGCAGGCAGGGAGAGAGG + Intronic
1102260662 12:111441313-111441335 GAGGCTGCAGTGAGCCAGCCTGG + Intronic
1102523826 12:113496749-113496771 AGGGCAGCAGGGAGGCCGGGTGG - Intergenic
1102561110 12:113762874-113762896 GGGGCTGGAGGAAGGCTGGGGGG - Intergenic
1103009557 12:117447880-117447902 ATGGCTGCAGGCAGGCAGCTGGG - Intronic
1103358966 12:120342510-120342532 AGGGCTGGAGGGAGGCGGCCAGG + Exonic
1103618927 12:122174043-122174065 AGGGCTGCAGGGATGGAGCCAGG - Intronic
1103950087 12:124545737-124545759 GGCGGCGCAGGGAAGCAGCGTGG - Intronic
1104270353 12:127277899-127277921 GTGGCTGCAGGGAGGATGCGGGG + Intergenic
1104335019 12:127886241-127886263 GGGGGTGCAGGTAGGAAGAGAGG + Intergenic
1104349933 12:128036132-128036154 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1104412552 12:128571554-128571576 GGGGCTGCGGGGAGGGGGAGTGG - Intronic
1104423350 12:128655129-128655151 GTGGGAGCCGGGAGGCAGCGTGG + Intronic
1104595048 12:130115248-130115270 GGGGCTTGCGGGAGGCGGCGTGG - Intergenic
1104845564 12:131845099-131845121 GGGCCTGCAGGGAGAGAGCCAGG - Exonic
1104896546 12:132167702-132167724 GAGGCTGCAGAGAGGGAGGGTGG - Intergenic
1105378018 13:19863054-19863076 CCGGCGGCAGGGTGGCAGCGCGG + Intronic
1105409644 13:20161100-20161122 GGGGCTGTTCGGAGGCGGCGGGG - Intergenic
1105437520 13:20391096-20391118 GGGGGTGCAAGGAGGAAGGGAGG + Intergenic
1105636482 13:22220533-22220555 GGGGCTGCAGGGAGGGGCTGGGG - Intergenic
1105799759 13:23893021-23893043 GGGGGTGCAAGGAAGCAGCAAGG - Intronic
1105847311 13:24304552-24304574 GGGGCTGCAGGGGAGAAGGGAGG - Exonic
1105849287 13:24320011-24320033 GGGGGTGCAAGGAAGCAGCAAGG + Intronic
1105859007 13:24393295-24393317 GGGGCTGCAGAGAGGCACTCGGG - Intergenic
1106411027 13:29511617-29511639 GGGTCTCCAGGGAGGCAGTGGGG - Exonic
1106588810 13:31080459-31080481 GGGGCTGGAGGGAGGGAGTCTGG + Intergenic
1107484653 13:40813970-40813992 GGGGCTGCAGTGTGGCAGCTTGG + Intergenic
1107742319 13:43464431-43464453 GGGGAAGGAGGGAGGCAGCCTGG + Intronic
1108077715 13:46698952-46698974 GGGGCTGCCGGGAAGGAACGAGG - Intronic
1108466018 13:50715916-50715938 GGAGCTGCAGGGTAGCAGCAAGG - Intronic
1108733742 13:53260832-53260854 GGAGCGGCAGGGAGGCGGCAGGG - Intergenic
1109756775 13:66771327-66771349 GGGGCTGAAGGGAGGAATGGAGG - Intronic
1110436516 13:75482265-75482287 GGGGCTGCAGGGCTGCGGCGCGG + Intergenic
1112356106 13:98675993-98676015 GGGGCTGCAGCGAGACTGCAGGG - Intergenic
1113201204 13:107868290-107868312 GGGTCTGGACGCAGGCAGCGGGG - Intergenic
1113462620 13:110492535-110492557 GGGGCTGTAAGGAGGCCCCGGGG - Intronic
1113568641 13:111337838-111337860 GAGGCTGGAGGAAGGGAGCGAGG - Intronic
1113591330 13:111503335-111503357 GTGGGCGCAGGGAGGCAGGGAGG + Intergenic
1113618452 13:111697188-111697210 GAGGTTGCAGGGAGGCAGAGAGG - Intergenic
1113623981 13:111782449-111782471 GAGGTTGCAGGGAGGCAGAGAGG - Intergenic
1113647327 13:112007931-112007953 GGGGCTGGAGTGAGACAGCCTGG - Intergenic
1113749811 13:112769270-112769292 GGGGCTGCAGGCACGCCGTGGGG - Intronic
1113849273 13:113408850-113408872 GGGGCTGCAGAGAGGAAGGGAGG + Intergenic
1113857593 13:113456542-113456564 AGTGCTGCAGGGGGGCAGCAAGG + Intronic
1113893720 13:113749745-113749767 GGGGCTGGAGGGAGGCACACGGG - Intergenic
1113899609 13:113788885-113788907 GGGGCAGGAGGGAGGGAGGGAGG - Intronic
1113947210 13:114051095-114051117 GGGGGTGCAGGAGGCCAGCGAGG - Intronic
1113955984 13:114099921-114099943 GGGGCTGCAGGGGGGCTGTGGGG - Intronic
1114312184 14:21477439-21477461 GGGGGAGCAGGGAGTCAGCTTGG - Intronic
1114386547 14:22261285-22261307 GGAACTGCAAGGCGGCAGCGAGG - Intergenic
1114524394 14:23359209-23359231 GGGACAGAAGGGAGGCAGGGAGG + Intronic
1114548556 14:23520387-23520409 GGGCCTCCAGGGGGGCAGCAGGG + Intergenic
1114571451 14:23672071-23672093 GGGACTGAAGGGAGGGAGCTGGG + Intergenic
1115018121 14:28641376-28641398 GGAACTGCAAGGTGGCAGCGAGG - Intergenic
1115653354 14:35419762-35419784 GGGACAGCAGGGAGTCAGCATGG + Intergenic
1116385941 14:44330001-44330023 TGGGCTGCTGGGTGGCAGCAAGG + Intergenic
1117279201 14:54220619-54220641 GGGGCTGGAGGGAGGGGGTGGGG + Intergenic
1117882716 14:60327978-60328000 GGGTTTGCGGGGAGGCAGCTCGG - Intergenic
1118006425 14:61568122-61568144 GGATCTGCAGGAAGGCAGGGTGG - Intronic
1118731354 14:68669329-68669351 GGGGAGGCAGGGAGGCAGTTAGG - Intronic
1119236871 14:73026961-73026983 GGGGCCGCAGGGCGCCAGTGGGG + Exonic
1119265016 14:73259381-73259403 GCTGCTGCAGAGAGGGAGCGGGG - Exonic
1119330031 14:73786947-73786969 GGTGCTGCAGGGAGGGAGCTCGG - Intronic
1119484173 14:74977584-74977606 GGAGCAGCAGGGAGGGAGTGAGG - Intergenic
1119717454 14:76868907-76868929 GGGGCTGCAAGGAGTGAGTGGGG + Intronic
1120370321 14:83626007-83626029 AGGGTTGCAGTGAGGCAGTGGGG + Intergenic
1121916012 14:97837436-97837458 AGGGCAGCAGGGAGGGAGGGAGG + Intergenic
1122233740 14:100320532-100320554 TGGGCTTCAGGCAGGCAGGGTGG - Intergenic
1122275225 14:100587481-100587503 GGCGCTGCCGGGAGGACGCGCGG - Intergenic
1122453173 14:101828230-101828252 GGGGCTGCGGGGAGGGAGGAAGG + Intronic
1122552492 14:102557458-102557480 GTGGGTGCCGGGAGGCAGGGAGG + Intergenic
1122609206 14:102969703-102969725 GGGGCTGGAGGGTAGCAGGGAGG - Intronic
1122783165 14:104152258-104152280 GGTCCTGCAGGGAGGCAGCCAGG + Exonic
1122846190 14:104500486-104500508 GGGGCCGCAGAGAGGCACCCGGG - Intronic
1122854743 14:104554687-104554709 CGGCCTGCAGGAGGGCAGCGAGG - Intronic
1122855757 14:104559416-104559438 GGGGATGGAGGGAGGCCGGGTGG - Intronic
1123040363 14:105487813-105487835 GGGGCTGAAAGCAGGCAGCCAGG + Intronic
1123427476 15:20184065-20184087 TGGGCTTCAGGGAGGCAGGCAGG - Intergenic
1123536712 15:21190615-21190637 TGGGCTTCAGGGAGGCAGGCAGG - Intergenic
1124343283 15:28903674-28903696 TGGACTGTAGGGAGGCAGTGGGG - Intronic
1124564611 15:30801709-30801731 GGGGCTGCAGGCAAGCATGGTGG + Intergenic
1124797681 15:32798271-32798293 GGGGCTGCAACGAGGCTGAGCGG + Intronic
1125317977 15:38452893-38452915 GAGGGTGCAGGGAGGCAGGGAGG - Intergenic
1125536055 15:40441587-40441609 GCGGCCGCAGGGTGGCAGCTCGG + Intronic
1125766914 15:42142294-42142316 GGGCCCGCAGGGAGCCAGCCAGG - Intronic
1127399528 15:58572523-58572545 GGAGCAGCAGGGAGGCTGGGAGG - Intergenic
1127867539 15:63043990-63044012 GGGGGTACAGGGAGGGAGGGGGG - Intronic
1128114499 15:65096753-65096775 TGTCCTGCAGGGAGGCAGTGTGG + Intronic
1128145484 15:65330394-65330416 GGGTCTGGAGGAAGGCAGGGCGG + Exonic
1128220586 15:65965546-65965568 GGGGCTGGAGGGAGCCAGTGAGG + Intronic
1128345969 15:66852622-66852644 GGGGAGGCTGGGAGGTAGCGGGG - Intergenic
1128943660 15:71807765-71807787 GGGGCTGAGGGGTGGCAGGGAGG - Intronic
1128982376 15:72197219-72197241 GCGGCTGCGGGGAGGCAGCTCGG - Intronic
1129061213 15:72861734-72861756 GGGGCTGCAGGGCAGCAGGCAGG - Intergenic
1129107236 15:73318785-73318807 GGGGCTGTGGGGAAGCAGTGGGG - Intergenic
1129198615 15:73985462-73985484 GGGGCTGGAGGTAGACCGCGTGG - Exonic
1129698804 15:77755785-77755807 GGGGAGACAGGGAGGCAGCCAGG - Intronic
1129868108 15:78924196-78924218 GGGGCTGCAGGGTGGAACGGCGG + Intronic
1130051135 15:80484828-80484850 AGGGGTGTAGGGAGGCAGCGGGG + Intronic
1130603438 15:85293933-85293955 GGAGCAGGAGGGAGACAGCGGGG + Intergenic
1130650422 15:85759454-85759476 GGGACTGCAGGGAGGGTGCCTGG - Exonic
1131030913 15:89185364-89185386 GGGGGTGCAGGCGGGCAGCCAGG - Intronic
1131305751 15:91241653-91241675 GGGTCAGCACAGAGGCAGCGAGG - Intronic
1131334566 15:91535649-91535671 GGGGCAGTAGGGAGGGAGCCTGG - Intergenic
1131653389 15:94427476-94427498 GGGGCTGGAGGGAGACAGCAAGG + Intronic
1132212705 15:100036206-100036228 GAGGGTGCAGAGAGGCAGCAAGG + Intronic
1132248349 15:100315154-100315176 CGGGAGGCAGGCAGGCAGCGTGG + Intronic
1132279805 15:100602823-100602845 AGAGGTGCAGGGAGGCAGGGAGG - Exonic
1132390465 15:101434759-101434781 CGGGATGCAGGCAGACAGCGCGG + Intronic
1132449978 15:101961712-101961734 GGGGCTGGAGGGAGGCGGGCGGG + Intergenic
1132498837 16:275876-275898 GGGGCGGCCGGGGGGCGGCGCGG + Exonic
1132584398 16:700039-700061 GGGGAGGCAGGGAGGCAGGGAGG + Intronic
1132656122 16:1042698-1042720 GGGGCTGCAGAGAAGCAGGCAGG + Intergenic
1132675523 16:1119783-1119805 GGGGCAGCAGGGGGGCATCGGGG - Intergenic
1132678663 16:1130905-1130927 GGGGGAGCAGGGATGCAGTGGGG + Intergenic
1132748592 16:1447148-1447170 GGGGGTGCAGGGAGCCAGCTTGG - Intronic
1132806762 16:1778559-1778581 GGGGATGGATGGCGGCAGCGTGG + Exonic
1132808661 16:1787421-1787443 GGGGCCTCGGGGAGTCAGCGGGG + Intronic
1132810223 16:1793666-1793688 CAGGCTGCAGGCAGGCAGCGAGG + Exonic
1132835445 16:1950688-1950710 GGGGCTGCACGTGGCCAGCGAGG + Intronic
1132878009 16:2148825-2148847 TGGGCAGCGTGGAGGCAGCGGGG - Exonic
1132906497 16:2285266-2285288 GAGGGTGCAGGGAGGAGGCGAGG + Intronic
1132975717 16:2710189-2710211 GTGGCTCCAGGAAGCCAGCGTGG + Intergenic
1133052277 16:3124079-3124101 GGGGCCGCAGGGAAGCAGGTGGG - Intergenic
1133058290 16:3158400-3158422 TGGCCTGCTGGGAGGCGGCGGGG + Intergenic
1133139891 16:3735971-3735993 GGAGCTGCAGGGTGGCAGGCTGG - Intronic
1134012929 16:10868655-10868677 GGGGCTGCAGCCAGGGAGAGAGG - Intergenic
1134093212 16:11402523-11402545 GGGGTTCAAGGGAGGAAGCGGGG - Intronic
1134112641 16:11524741-11524763 GTGGCTGGAGGGAGGGAGGGAGG - Intergenic
1134624703 16:15715131-15715153 GGGGCTCGAGGGAGGCTGGGTGG + Intronic
1135119604 16:19754164-19754186 GGAGCTGCAGGGTGGCAGTTTGG + Intronic
1135342844 16:21663953-21663975 GGGGCGGCAGCTAGGAAGCGAGG - Intergenic
1135884643 16:26294989-26295011 GGGGTTGCAGAGAAGCAACGTGG - Intergenic
1136418046 16:30115399-30115421 GAGGAGGCAAGGAGGCAGCGTGG + Intronic
1136478205 16:30526250-30526272 GTGGCTCCAGGGAGGGAGCGAGG - Intronic
1136577414 16:31132744-31132766 TTGGCTGCAGGGAGGCAGATGGG + Exonic
1136579301 16:31142330-31142352 TGGGCTCTAGGGAGGGAGCGGGG - Intronic
1136624487 16:31453675-31453697 GGGGTGGCAGGGAGACAGGGAGG + Intergenic
1136627877 16:31472788-31472810 GGGGATGCAGGGATGGAGAGAGG + Intronic
1136637843 16:31537306-31537328 AGGGCGGCCGGGAGGCATCGAGG - Intergenic
1136683607 16:31981749-31981771 GGGGCTCCTGGTAGGCAGCGTGG + Intergenic
1136784236 16:32925309-32925331 GCGGCTCCTGGTAGGCAGCGTGG + Intergenic
1136885548 16:33928497-33928519 GCGGCTCCTGGTAGGCAGCGTGG - Intergenic
1137555035 16:49465088-49465110 TGGGCTGCGGGGAGGCGGAGAGG + Intergenic
1137569624 16:49557154-49557176 GGGCGTGCAGGGCGGCAGAGGGG + Intronic
1137596192 16:49725644-49725666 GGGGCTGCAGAGGGCCAGCAGGG + Intronic
1137668651 16:50266625-50266647 GGGTCTGCAGGGAGGTGGCCCGG - Intronic
1137815201 16:51392115-51392137 GGGGCTCCAGGGGGGCTGGGAGG - Intergenic
1138106015 16:54287403-54287425 GGGGCTGAAGGGTGGCAGCCCGG + Intergenic
1138370734 16:56524525-56524547 AGGCCTGGAGGGAGGCAGCGTGG + Intergenic
1138667053 16:58579720-58579742 AGGGCTACAGGGAGAGAGCGCGG - Intronic
1138679520 16:58674936-58674958 AGGGCTGCTGGGAGTCATCGAGG - Intronic
1138992190 16:62404986-62405008 GGGGCTGCAGGGAGGGTCCTTGG - Intergenic
1139361278 16:66401726-66401748 AGGGTTGCCGGGAGGCAGCGTGG + Intronic
1139601688 16:67991253-67991275 GGGGGTGCAGGGATGGAGGGTGG - Intronic
1140036646 16:71376365-71376387 AGAACTGCAGGGAGGCAGAGCGG - Intronic
1140223358 16:73059183-73059205 GGAGGTGGAGGGAGGCAGAGGGG + Intronic
1140225098 16:73070782-73070804 GGCGCTGGAGAGAGGCAGAGAGG - Intergenic
1141096582 16:81167414-81167436 AGGGCTTCTGGGAGGCAGTGTGG - Intergenic
1141432843 16:83979756-83979778 GGGGGTGCAGGGAGGACTCGCGG + Intronic
1141599841 16:85118959-85118981 GAGACTGGAGGCAGGCAGCGAGG - Intergenic
1141604007 16:85142773-85142795 GGGGTTGTAGGGGGGCAGTGGGG + Intergenic
1141636615 16:85317369-85317391 GGAGCTGGAGGTAGGAAGCGTGG - Intergenic
1141927307 16:87177975-87177997 GGGGTTGCAGGGAGGAGGCTGGG + Intronic
1142001280 16:87665717-87665739 GGGGCAGCCGGGAGGAAGAGGGG - Intronic
1142051291 16:87959839-87959861 GGGGCCGCAGGGAGGTGGCCGGG + Intronic
1142086710 16:88187030-88187052 GGGGCGGCTGGGAGGCCCCGGGG + Intergenic
1142102985 16:88285420-88285442 GGGGCTGTGGGGAGACAGTGTGG + Intergenic
1142108727 16:88319758-88319780 TGGGCTGCAGGGAGGCCTGGGGG - Intergenic
1142127165 16:88415893-88415915 GGGGCGGCAGGCACGCAGCCCGG + Intergenic
1142156442 16:88534673-88534695 CGGGCTGCGGGGAGGCGGCGGGG - Exonic
1142196027 16:88739697-88739719 GGGGCTGCTGGGAGGCTCCGAGG + Intronic
1142228705 16:88889402-88889424 GGGGCGGGAGGGAGGGAGCGAGG + Intronic
1142310181 16:89307667-89307689 GGAGCTGCAGCCAGGCGGCGGGG - Intronic
1142312360 16:89321385-89321407 GGGGCTGCAGGGCGGGACTGTGG + Intronic
1142356225 16:89603473-89603495 GGGGCTGGAGGGAGGCACTGGGG + Intergenic
1142356235 16:89603493-89603515 GGGGCTGGAGGGGGGCACTGGGG + Intergenic
1142356392 16:89603875-89603897 GGGGCTGGAGGGAAGCAGTGGGG + Intergenic
1142356459 16:89604057-89604079 GGGGCTGGAGGGAAGCACTGGGG + Intergenic
1142356492 16:89604138-89604160 GGGGCTGGAGGGAAGCACTGGGG + Intergenic
1142356507 16:89604180-89604202 GGGGCTGGAGGGAAGCACTGGGG + Intergenic
1142356633 16:89604525-89604547 GGGGCTGGAGGGAAGCACTGGGG + Intergenic
1142356653 16:89604585-89604607 GGGGCTGCAGGGGAGCAGTGGGG + Intergenic
1142359198 16:89618915-89618937 GGAGCTGCAGGGAGGGAGCAGGG - Intronic
1142359335 16:89619220-89619242 GGGGCTGCAGGGAGGGAGCAGGG - Intronic
1142449888 16:90168445-90168467 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203086893 16_KI270728v1_random:1189315-1189337 GGGGCTCCTGGTAGGCAGCGTGG + Intergenic
1142457198 17:63401-63423 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1142614249 17:1125571-1125593 GGGGCTGCTGGGAGGCGGGGAGG + Intronic
1142681894 17:1554916-1554938 GGGGCTCCAGGGGGGCATTGAGG - Intronic
1142690552 17:1603912-1603934 GAGACTCCAGAGAGGCAGCGTGG - Intronic
1142781056 17:2181672-2181694 TGGGCTACAGAGAGGCAGAGGGG - Intronic
1142851069 17:2704990-2705012 TGGGCTGCAGGGGGGCTGCAGGG + Intronic
1143014157 17:3882870-3882892 GGGGCTGCAGGAAGGCTTTGGGG - Intronic
1143524551 17:7464470-7464492 GGGGCTGGAGGGAGGCAGACCGG + Intronic
1143601565 17:7949403-7949425 GGGGCTGTAGCAAGGCGGCGAGG - Exonic
1143658746 17:8312234-8312256 GGGGCTTGAGGGATGCAGCTGGG - Exonic
1143739472 17:8941997-8942019 GGGGCTTCAGGGAGGCTCAGGGG + Intronic
1143923090 17:10346433-10346455 GGAGCTGGAGGGAGGCTGCCTGG + Intronic
1144585618 17:16485910-16485932 GGGGATGCAGGGAGGAATCATGG + Intronic
1144685999 17:17226852-17226874 GTGGCTGCAGCGGGGCAGCGGGG - Intronic
1144773533 17:17772404-17772426 GTGGCTGCAGTGAGGCAGGATGG - Intronic
1144816985 17:18041188-18041210 GGGGCGGGGGGGAGGCAGTGGGG - Intronic
1144873388 17:18383608-18383630 AGGGCGGCAGGGCGGCAGGGCGG + Intronic
1144945343 17:18966873-18966895 GGGGCTGCAGGGTGCCGGCAGGG + Intronic
1145031466 17:19507809-19507831 GGGGATTCTGGGAGGGAGCGAGG - Intronic
1146095987 17:29930430-29930452 GGGGCCGAAGGGAGCCAGCCCGG + Intronic
1146126861 17:30237309-30237331 GGGGCTGCAGGGGGGATGCTGGG + Intergenic
1146172050 17:30641935-30641957 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146345508 17:32057971-32057993 GGGGCTGCTGGGAGCCAGAGAGG - Intergenic
1146375753 17:32293161-32293183 GGGGCTGGAGGGAGGGGGTGGGG + Intronic
1146496869 17:33330360-33330382 AGGACTGCAGGGAGGCTGCTGGG + Intronic
1147144525 17:38477456-38477478 GGGGCTCCTGGTAGGCAGCGTGG + Intronic
1147179508 17:38675110-38675132 GCGGCGGCTGGGAGGGAGCGCGG + Exonic
1147247641 17:39132681-39132703 AGGGCTGAATGGAGGCAGCTGGG + Intronic
1147285937 17:39402336-39402358 GGTGCTGCAGGGAGGCCTGGGGG + Intronic
1147571919 17:41576664-41576686 GGGGCTGCAAGGACCCAGAGAGG + Intergenic
1147614362 17:41819596-41819618 GGGGCTGCAGGGTGCCTGCATGG + Exonic
1147671546 17:42179846-42179868 GGAGCTGGAGGGAGACAGCTCGG - Intronic
1148044120 17:44732050-44732072 GGGACTGCAGGGAGGCAGGTAGG - Intronic
1148558768 17:48594104-48594126 GAGCCTGCAGGGAGCCAGCAGGG - Intronic
1148591163 17:48817439-48817461 GGGGCTGCGGTGAGGGAGGGGGG + Intergenic
1148778049 17:50106775-50106797 AGGGCTGCAGGCAGGAAGGGAGG - Exonic
1148857314 17:50585809-50585831 CAGGCTGCAGTGAGGCAGTGAGG - Intronic
1149564767 17:57633330-57633352 GGGGATGCCAGGAGGCAGGGAGG - Intronic
1149893722 17:60412658-60412680 GGGCCTGAAGGGAGGGAGTGGGG + Intronic
1150168268 17:62965921-62965943 GGGGCAGCAGGGAGGACGCTCGG - Intergenic
1150656300 17:67041945-67041967 GGGGAACCAGGCAGGCAGCGCGG + Intergenic
1150764594 17:67993388-67993410 GGGGCGGCGGGGCGGCGGCGCGG + Intronic
1150833269 17:68542055-68542077 GGGACGGCAGGAAGGCAGAGAGG + Exonic
1151408032 17:73902199-73902221 GGGCGGGGAGGGAGGCAGCGAGG - Intergenic
1151517942 17:74608693-74608715 GGGCCTGCAGGGATGCTGTGTGG - Intergenic
1151553987 17:74837445-74837467 AGGGCTCCAGTGGGGCAGCGAGG - Exonic
1151579694 17:74971228-74971250 GGGGAGGCAGGGAGGAAGGGAGG - Intronic
1151623538 17:75262031-75262053 GGGGCCACAGGCAGGCCGCGTGG + Intronic
1151805581 17:76402928-76402950 GGGGCTGCCTGGAGGGAACGGGG + Intronic
1151830208 17:76544979-76545001 GGGGCTGCTGGCGGCCAGCGGGG + Intronic
1152037197 17:77880705-77880727 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1152037200 17:77880713-77880735 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
1152045181 17:77930683-77930705 GGAGCTGCAGGGGGGAAGCTGGG - Intergenic
1152072577 17:78141128-78141150 GGGGCCCCAGGGAGGCTTCGGGG - Exonic
1152212121 17:79008277-79008299 GGGGCTGCAGGGAGGGTCTGTGG + Intronic
1152343368 17:79737498-79737520 GGGGCTGGAGGGAGCGAGGGTGG + Intronic
1152392364 17:80010390-80010412 GGGGCTGCAAGCAGGCTGCGAGG + Exonic
1152630407 17:81408401-81408423 GGGGGTGCAGGGTGGGAGCCTGG - Intronic
1152642581 17:81455300-81455322 GGAGCTGCGAGGAGGCAGTGGGG + Exonic
1152822031 17:82442335-82442357 AGGGCTGGTGGGTGGCAGCGGGG - Exonic
1152920415 17:83063872-83063894 GGGGATGCGGGGAGGGGGCGTGG - Intergenic
1153442237 18:5133125-5133147 CGGGTTCCCGGGAGGCAGCGAGG + Intergenic
1153636651 18:7118125-7118147 GGGACTGCAGGGCCGCGGCGGGG - Intergenic
1153851851 18:9102586-9102608 GGGGCTGACGGGAGGGAGCGAGG - Intergenic
1153934032 18:9904899-9904921 GAGGCTGCAGGGAAGGAGAGGGG - Intergenic
1154030663 18:10750974-10750996 GGGTCTGCAGGGAGACAAAGGGG - Intronic
1154198774 18:12285105-12285127 GGGGGCTCAGGGAGGCAGCCCGG + Intergenic
1155145397 18:23079030-23079052 GGGGCTGCAGAGAGCCAGGCTGG + Intergenic
1156229222 18:35137826-35137848 GGGGCTGCAGGCAGTGAGAGAGG + Intronic
1156331657 18:36129283-36129305 GCGGCTGCCGGGTGGCTGCGCGG - Exonic
1156485336 18:37462115-37462137 GGTGCTCCAGGGAGTCAGCAGGG - Intronic
1156602049 18:38619426-38619448 AGGGAGGCAGGGAGGCAGGGAGG - Intergenic
1156602052 18:38619434-38619456 AGGGAGGCAGGGAGGCAGGGAGG - Intergenic
1156602055 18:38619442-38619464 AGGGAGGCAGGGAGGCAGGGAGG - Intergenic
1157134341 18:45039314-45039336 GGGGCTGGTGGGAGGCACTGTGG - Intronic
1157235487 18:45961409-45961431 GGAACTGCAAGGAGGCAGTGTGG - Intronic
1157274600 18:46301928-46301950 GGAGCAGCTGGGAGGCAGCAGGG - Intergenic
1157280386 18:46343201-46343223 GGGGCTGCTGGTGGGCAGAGAGG - Intronic
1157600061 18:48888273-48888295 GGGGCTGCCGGGAGGGAAAGGGG - Intergenic
1157615773 18:48986989-48987011 AGGGCTGCAGGGCTGCAGCCTGG - Intergenic
1157617272 18:48994724-48994746 GGGGTTGCGGGGAGGAAGGGAGG - Intergenic
1157903793 18:51547357-51547379 GGGGGTGCAGGGAAGTAGGGAGG - Intergenic
1157920134 18:51706316-51706338 GGAACTGCAAGGTGGCAGCGAGG - Intergenic
1160031965 18:75269816-75269838 GTGGCTGCTGGGAGCCAGGGGGG - Intronic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160239780 18:77114865-77114887 TGGGCTGCAGGGAGGAAGTGGGG + Intronic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1160373425 18:78392415-78392437 GGGTCTGCAGGGACGCCGCAAGG + Intergenic
1160451486 18:78969467-78969489 GGGGCTGCAGGGAGGTGTTGGGG + Intergenic
1160453515 18:78980366-78980388 GGGGCTGCGGGGTGGCCGGGGGG + Intronic
1160566266 18:79788338-79788360 GGGCCTGCCGGGCGGGAGCGCGG - Intergenic
1160580126 18:79879025-79879047 GGGTCTCCAGGGAGGCGGCATGG - Intronic
1160635276 19:70836-70858 GGGGCTGGAGGGAGGCGGGCGGG - Intergenic
1160647557 19:200506-200528 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1160671827 19:368795-368817 GAGGCTGGAGGGAGCCAGGGAGG - Intronic
1160675885 19:390984-391006 GGGCCTGCAGTGGAGCAGCGTGG - Intergenic
1160725486 19:616278-616300 GGGGGCGCCGTGAGGCAGCGAGG - Exonic
1160738946 19:677197-677219 GGGGCTGCAGGGATGGGGGGTGG - Intronic
1160747648 19:719509-719531 GCGGCTGCCGGGAGCCAGGGAGG + Intronic
1160812617 19:1019494-1019516 GGGGCTGCAGGGAGGAAGGTGGG + Intronic
1160834834 19:1119733-1119755 GGGCCTGAAGAGAGCCAGCGTGG + Intronic
1160858573 19:1228119-1228141 GGAGCTGCTGGGTGGCAGGGGGG + Exonic
1160923054 19:1529515-1529537 GGGGCTGCAGGTGGGGAGGGAGG + Intronic
1160972711 19:1776472-1776494 GGGCTTGCAGGGGGGCAGCGGGG + Exonic
1160977449 19:1800335-1800357 GGGGGTGCATGGGAGCAGCGTGG - Exonic
1160990760 19:1859475-1859497 GGGGCGGCAGTGAGGCAGGCTGG - Intronic
1160997195 19:1888260-1888282 GGGGCTGCAGGGAAGATGGGAGG - Intergenic
1161056203 19:2191714-2191736 GGGGATGCAGGGAGGGCGCGAGG - Intronic
1161067957 19:2247809-2247831 GGGCCAGCAGGGAGGCTGGGTGG - Exonic
1161202688 19:3024820-3024842 GGGGCTGCAGGGATGGAGGGAGG - Intronic
1161303168 19:3552902-3552924 AGGGCTGCAGGGAAGGAGCCTGG - Intronic
1161321862 19:3645165-3645187 GGGGTTGCAGGGAGGTGGCAGGG - Intronic
1161329029 19:3677787-3677809 AGGGATGCAGGGAGGGAGGGAGG + Intronic
1161333747 19:3700194-3700216 GGGGCTGCACGGTCGCTGCGGGG - Intronic
1161480041 19:4505871-4505893 GGGGCTGAGGGGAGGCCGGGCGG - Intronic
1161570927 19:5030569-5030591 CGGCCTGCAGAGAGGCAGCCAGG + Intronic
1161610617 19:5240337-5240359 GGGGGTGCAGGGAGACAACTAGG + Intronic
1162128812 19:8513145-8513167 GGGGCTGGAGGGATGCAGCAGGG - Exonic
1162316995 19:9945607-9945629 GAGGCTGCAAGGAGGGAGTGAGG + Intergenic
1162337868 19:10072836-10072858 GGGGCTGAAGGGAGGGAGGGTGG + Intergenic
1162646748 19:12055690-12055712 GGGGCTGCAGGAAGGCAGAGAGG - Intergenic
1162990373 19:14298102-14298124 GCGGCTGCTGGGAGCCAGAGAGG + Intergenic
1163169941 19:15524286-15524308 GGGGCTCCAGGGAGGGAGAATGG + Intronic
1163311048 19:16514771-16514793 AGGGCTGCAGGGATGCAGTGGGG + Intronic
1163426852 19:17245049-17245071 GGGGCTGCAGGTGGACTGCGTGG - Exonic
1163575930 19:18110678-18110700 GGGGCTGCTGGGACCCAGCAGGG - Intronic
1163634298 19:18431265-18431287 GGGGCTCCATGGAGGCAGAGGGG - Intronic
1163673700 19:18644724-18644746 GGGGCTGCTGGGGGGCAGTGGGG + Intronic
1163785504 19:19273028-19273050 TGGGCTGGAGGGAGGATGCGCGG - Intronic
1164723538 19:30450314-30450336 GGGGCTGGAGGGGGGGAGAGGGG + Intronic
1164754996 19:30682682-30682704 CGGGCTGAGGGGAGGCAGAGAGG - Intronic
1164919603 19:32079008-32079030 GCGGCTGCAGGGGGGCTGGGTGG - Intergenic
1165132317 19:33640807-33640829 GGGCCAGCAGGGAGGCGTCGTGG - Intronic
1165157642 19:33797601-33797623 GGGGGTGCGGGCGGGCAGCGGGG - Intronic
1165830176 19:38726795-38726817 GAGGCAGCAGGGAGGCACCATGG + Intronic
1165856369 19:38881069-38881091 GGGGATGCGGGGAGGCTGGGGGG + Intronic
1165928353 19:39341413-39341435 GGGAGTCCAGGGAGGCAGCTGGG - Intronic
1165955425 19:39499256-39499278 GGCGCTGCAGGGGGACCGCGGGG - Exonic
1166055438 19:40285354-40285376 GGGGCTGGGGGGAGGGGGCGGGG - Exonic
1166137657 19:40786990-40787012 GGGGCTTTAGGGAGGCAGGGCGG + Intronic
1166381346 19:42356844-42356866 GCGGCTGCATGGAAGGAGCGGGG - Exonic
1166602916 19:44113713-44113735 TGGGGTGCAGGGAGGCCGAGTGG - Intronic
1166824272 19:45599436-45599458 GGGGCTGCAGGGAGAAGGCGGGG - Intronic
1166888627 19:45976241-45976263 GGGGCTGCAGGCATGCCTCGGGG - Intergenic
1166942040 19:46373167-46373189 TGCCCTCCAGGGAGGCAGCGTGG - Intronic
1167113833 19:47477224-47477246 CGGGCTCCACGAAGGCAGCGTGG - Intronic
1167136755 19:47620981-47621003 GAGGCACCAGGGAGGCAGCCAGG - Intronic
1167583844 19:50361914-50361936 GGGGGTGAAGGGAGGAGGCGGGG - Intronic
1167743646 19:51339032-51339054 GGAACTGCAGGGAGGCAGCAGGG + Exonic
1168307153 19:55442093-55442115 GGGGCTGCAGGGATAGGGCGTGG - Intronic
1168316283 19:55486101-55486123 GAGGCTGGAGGGAGGCTGCTGGG - Intronic
1168316876 19:55488407-55488429 GAGGCTGCAGGGAGGCGGCAGGG - Intronic
1168404366 19:56103088-56103110 GGGTCAGGTGGGAGGCAGCGGGG + Intronic
1168406592 19:56113683-56113705 CGGGACGCAGGGAGGCAGGGAGG + Intronic
1168406595 19:56113691-56113713 AGGGAGGCAGGGAGGCAGGGAGG + Intronic
1168659570 19:58155243-58155265 GTGGCAGCAGGGAGGCTGTGGGG + Intergenic
1168665772 19:58203935-58203957 TGGGCTGCGAGAAGGCAGCGCGG + Intronic
1202696502 1_KI270712v1_random:130618-130640 AGGTCTGCAGGAAGGCTGCGAGG - Intergenic
925081708 2:1074157-1074179 GCAGCTGCCGGGAGGCAGCAAGG - Intronic
925446612 2:3931552-3931574 GGGGCTGCAGCAAGGCAGGCAGG + Intergenic
925834335 2:7929402-7929424 GATGCCGCAGGGAGGAAGCGAGG - Intergenic
925889743 2:8424049-8424071 TCGGCTGCAGGGAGGCCTCGGGG + Intergenic
926136903 2:10342889-10342911 GGGGCCGGGGGAAGGCAGCGGGG - Intronic
926165661 2:10521142-10521164 GAGGCTGGAGGGAGGGAGGGAGG + Intergenic
926167240 2:10528928-10528950 CGGGATGCAGGGAGGAAGTGGGG + Intergenic
926205094 2:10830129-10830151 GCGGGTGCAAGGAGGCAGTGTGG - Intronic
926240486 2:11081168-11081190 GGGGGTACAGGGAGGCATGGAGG - Intergenic
926679402 2:15652469-15652491 GGGGCTGCAGGGAGAGACCATGG - Intergenic
926699034 2:15790436-15790458 GGGACTGCAGTGAAGCAGGGAGG + Intergenic
927155876 2:20221102-20221124 TGGGGTGCAGGGAGGTAGAGGGG + Intronic
927444746 2:23149335-23149357 GCAGCTGCAGGGAGGGAGGGTGG - Intergenic
927783666 2:25957881-25957903 GCGGCTGCAGTGTGGCAGCATGG - Intronic
927884807 2:26711862-26711884 GGGGCTGGGGGGAGGGAGCAGGG + Intronic
927889361 2:26738743-26738765 GAGGTTGCTGGGAGGCAGGGAGG + Intergenic
927904292 2:26846559-26846581 TGGGCTTCAGGGAGGTGGCGTGG - Intergenic
928026187 2:27741249-27741271 GAGACTGCAGGGAGGGAGGGAGG - Intergenic
928314502 2:30235191-30235213 GGGGCAGTAGAGAGGCAGCAGGG - Intronic
928373756 2:30759082-30759104 AGGGATGAAGGGAGGCAGAGAGG - Intronic
928452510 2:31388999-31389021 GGCACTGCAGGGTGGCAGAGGGG + Intronic
929299607 2:40288055-40288077 GAGTCTGCAGGGAAGCAGTGAGG - Intronic
929777714 2:44939055-44939077 GGTGCGGCAGGGCGGCAGGGCGG + Intergenic
929787408 2:45002451-45002473 GGGGGTGAAGGGTGGCAGAGAGG + Intergenic
930750801 2:54932412-54932434 GGGGATGAAGGAGGGCAGCGTGG - Intronic
930930274 2:56874382-56874404 TGGGCTGAAGGGAGGAAGCTGGG + Intergenic
931538649 2:63304770-63304792 GGGGCTGAAGGCAGGGAGCCAGG + Intronic
932073782 2:68644760-68644782 GGGACTGCAGGGAGAGAGCAGGG + Intronic
932126694 2:69151367-69151389 GTAGCTGTAGGGAGGCAGGGTGG + Intronic
932583451 2:73007617-73007639 GGGTATGTGGGGAGGCAGCGTGG - Intronic
932702248 2:73999975-73999997 AGGGCTGCTGGAAGGCAGGGTGG + Intronic
933571090 2:84013504-84013526 GAGGTTGCAGGGAGGGAGGGTGG + Intergenic
933666853 2:84971266-84971288 GCGGCGGCGGGGAGGCGGCGCGG - Exonic
933779843 2:85794049-85794071 AGGGCTGGGGGGAGGCAGGGAGG - Intergenic
933902799 2:86861681-86861703 GGGGCGCCCGGGAGGCAGCTTGG - Intronic
934277664 2:91587643-91587665 AGGTCTGCAGGAAGGCTGCGAGG - Intergenic
935118274 2:100157378-100157400 CAAGCTGCAAGGAGGCAGCGAGG - Intergenic
935400199 2:102652366-102652388 TGGGCTGCAGGGGAGCAGAGGGG - Intronic
935746497 2:106194045-106194067 GGGGCTGCAGGGCCGCCTCGGGG + Intronic
935777748 2:106487588-106487610 GGGGCGCCCGGGAGGCAGCTTGG + Intergenic
936397716 2:112141702-112141724 TAGGCTCCAAGGAGGCAGCGTGG + Intronic
936566204 2:113584207-113584229 GGGGCTGGAGGGAGGCGGGCGGG + Intergenic
936846380 2:116839985-116840007 AGGGATGCAGGGAGGGAGGGAGG + Intergenic
937017594 2:118619938-118619960 GGGGCTGCTGGGTGACAGCAGGG - Intergenic
937122850 2:119452760-119452782 AGGGCAGCAGCGAGGCAGCGGGG - Intronic
937122853 2:119452768-119452790 GAGGCAGCAGGGCAGCAGCGAGG - Intronic
937236323 2:120433664-120433686 GAGGCTGCAGAGAGGCTGCGTGG + Intergenic
937241949 2:120467573-120467595 TGGGCTGCAGGGAGCCAGGGTGG + Intergenic
937263626 2:120602015-120602037 GAGCCTGCAGGGAGGCTGCTGGG - Intergenic
937991220 2:127663611-127663633 GGGGGGGCAGGGAGGGAGCCAGG - Intronic
938125727 2:128669954-128669976 GTGGCTGCAGGGAGGCAGCCGGG + Intergenic
938392277 2:130915721-130915743 GGGGCCGCAGTGAGACACCGTGG - Intronic
938463141 2:131510722-131510744 GGTGCTGCAGGGCAGCAGCTCGG + Intergenic
938540501 2:132280499-132280521 GGGGCTTGGGGGGGGCAGCGGGG + Intergenic
938662190 2:133498526-133498548 AGGGCGGCAGGGAGGAAGGGAGG + Intronic
939629701 2:144516992-144517014 GGGGCTCGAGGGGGGCAGCGGGG + Intronic
939777637 2:146406146-146406168 CAAGCTGCAGGGCGGCAGCGAGG + Intergenic
940008263 2:149029670-149029692 CGGTCTGCAGGCAGGCAGCCAGG - Intergenic
940775178 2:157876636-157876658 GGGGCTCCTCGGAGGCGGCGGGG + Intergenic
942023883 2:171894135-171894157 GGGGCTGCAGGCAGGGCGCTCGG + Intronic
942219996 2:173759664-173759686 GGGGTTGCAGGGAGTCAGAGTGG + Intergenic
942919117 2:181349559-181349581 GGGGCTAAAAGGAGGCAGAGGGG + Intergenic
944412601 2:199458340-199458362 GGGGCGGGTGGGAGGCAGGGAGG + Intronic
945051294 2:205826715-205826737 GGGGCTGCAGAGAGGAACCCTGG + Intergenic
946028628 2:216687845-216687867 GGGGCGGCAGGGAGGAAGTAGGG + Intronic
946612954 2:221478803-221478825 GAGGCTGCAGGTAGCCAGCTGGG + Intronic
946669871 2:222091256-222091278 AGGGCTTCAGGGAGGCGGCGAGG - Intergenic
946708869 2:222486134-222486156 TGGGCTGCACGGTGGCAGGGAGG + Intronic
947140286 2:227014052-227014074 GGGGCCGCAGAGGGGCAGGGAGG - Intronic
947863880 2:233382524-233382546 GGGGCTGCAGGCAGACAGCTGGG - Intronic
947941193 2:234057123-234057145 GGGGCAGCAGGAAGCCAGTGGGG - Intronic
948086779 2:235257014-235257036 GGGGCTGTGGGGAGGTAGCAGGG - Intergenic
948141785 2:235678723-235678745 GGGGCGGGAGGGAGGCAGGCAGG - Intronic
948171136 2:235904259-235904281 AGGGTTGCAGGGGGACAGCGAGG + Intronic
948262596 2:236615166-236615188 GCAGCTGCAGGGAAGCAGCAGGG - Intergenic
948630545 2:239299853-239299875 GAGCCTGCAGGGACGCAGCTGGG + Intronic
948631700 2:239306863-239306885 GGAGCTGCAGGGATGCATGGGGG + Intronic
948650662 2:239441384-239441406 AGGGCAGCAGGGAGGGAGGGAGG + Intergenic
948673764 2:239585060-239585082 AGGGCAGCAGGGGGGCAGCAGGG - Exonic
948678044 2:239610647-239610669 GTGGATGCAGGGAGGCAGGGAGG + Intergenic
948801242 2:240434636-240434658 GGGTCTGTAGGGAGGGGGCGAGG - Intergenic
948815843 2:240510069-240510091 AGGGGGGCAGGGAGGCAGGGAGG - Intronic
948867238 2:240782337-240782359 GGGGCTGCTGGGAGACACCGAGG - Intronic
948908868 2:240993047-240993069 GGCGCTGCAGGGATGCAAAGAGG - Intronic
949035989 2:241815977-241815999 GGGGCTGGAGGAAGGCACAGGGG - Intronic
949042199 2:241854579-241854601 AGGGCTCCTGGGAGGCAGCCTGG + Intronic
1168833119 20:858252-858274 TGGGCTGCAGGGCTGCAGGGAGG + Intergenic
1168856647 20:1013569-1013591 GGGGCTGCAGGGAGGCAGTGAGG - Intergenic
1168963652 20:1885961-1885983 GGAGCTGCAGGCAAGCAGTGTGG - Intergenic
1168966150 20:1899324-1899346 TGGTCTGCAGGGAGGAAGCCTGG - Intronic
1168974364 20:1953092-1953114 GGGGATGGAGGGAGGGAGGGAGG + Intergenic
1169021194 20:2332368-2332390 GGGGCTGCAGGGTGTCTGCTGGG + Intronic
1169128285 20:3146994-3147016 GGGTCTGCATGCAGGCTGCGGGG + Exonic
1169130772 20:3165451-3165473 GGGACAGAAGGGAGGCAGAGGGG + Intronic
1169256867 20:4106303-4106325 GGCGCTGCAGTGGGGCAGAGGGG + Intergenic
1169365271 20:4987068-4987090 AGGGCTGCAGGTGGGCAGCGTGG + Intronic
1170394907 20:15915678-15915700 GGGGGTGTAGGGAGGCAGGTTGG + Intronic
1170510059 20:17067252-17067274 GGAGCTGCTGAGAGGCAGGGGGG + Intergenic
1170890077 20:20368837-20368859 GGGGCCGCAGGGCGGCGGCAGGG - Exonic
1171013848 20:21522764-21522786 GGGGCTGCGCGGTGGCCGCGGGG - Intergenic
1171185586 20:23121900-23121922 GGGGCTGCAGAGGGGGAGGGTGG + Intergenic
1171373429 20:24676101-24676123 AGGGCTGTAGGCAGGCAGGGTGG - Intergenic
1171401772 20:24877815-24877837 GTGGCTGGAGGGAGGAAGTGTGG + Intergenic
1171414479 20:24968379-24968401 GAGGCTGCAAGAAGGCAGCAGGG + Intronic
1171468942 20:25354361-25354383 TGGGGGGCAGGGAGGCAGGGAGG + Intronic
1171481723 20:25459936-25459958 GGTGCTGGAGTGAGGCAGAGCGG + Intronic
1171498100 20:25571483-25571505 AGGGCTGCAGGGAGGAAGGAAGG + Intronic
1171779634 20:29407952-29407974 TGGGCGGAAGGGAGGCAGCCTGG + Intergenic
1171846682 20:30281643-30281665 AGCGCTGCGGGGTGGCAGCGAGG - Intergenic
1172114010 20:32563130-32563152 GAGGCTGGAGGGAGGGAGAGTGG + Intronic
1172427233 20:34863545-34863567 GGGTCTGCGGGCAGGCAGCCGGG + Exonic
1173012589 20:39195728-39195750 GGTGCTGCAAGGGGGCAGAGTGG - Intergenic
1173103669 20:40111009-40111031 GGGGCAGCAGGTAGGGAGTGAGG + Intergenic
1173846769 20:46193361-46193383 GGAGCTCCAGGGAGGCTGCCCGG - Intronic
1174065243 20:47860023-47860045 GTGGCTGCAGAGAGGCAGGATGG - Intergenic
1174180074 20:48669035-48669057 AGGGCTGCAGGGAGGTGGCAGGG - Intronic
1174192057 20:48747647-48747669 GGGGCTGAAGGGAGCAAGCTGGG + Intronic
1174289876 20:49500492-49500514 GGAGCAGGAGGGAGGCAGTGTGG - Intergenic
1174529473 20:51199500-51199522 AGTGATGCAGGGAGGCAGGGAGG - Intergenic
1174612197 20:51807142-51807164 GGGGCTGGAGGGAGGGAGAGTGG + Intergenic
1174741068 20:53014813-53014835 GGGGCTTCAGGGAGGTGGAGGGG - Intronic
1175216838 20:57395688-57395710 GCAGCTCCAGGGAGGCAGCGGGG + Intronic
1175217341 20:57398538-57398560 GGGGGGGCAGGGGGGCGGCGGGG - Intronic
1175222494 20:57425476-57425498 GGAACTGCAGGGAGGCCGGGAGG + Intergenic
1175437688 20:58965788-58965810 GGTGGTGCAGGGATGCAGCTGGG + Intergenic
1175705988 20:61177112-61177134 GGAGCTGGAGGGAGGGAGGGAGG + Intergenic
1175787385 20:61720489-61720511 AGGGGTGCAGGGATGCAGAGTGG + Intronic
1175858227 20:62134067-62134089 GGGGCAGGAGGGAGGCTGAGTGG + Intronic
1175860913 20:62149531-62149553 GGAGCTGCAGGAGGGCAGGGTGG + Intronic
1175899344 20:62353868-62353890 TGGGCTGCAGGGAGCAAGCGGGG + Intronic
1175900437 20:62357894-62357916 TGGGCTGCAGGGAGGGAGCCTGG - Intronic
1176015569 20:62929449-62929471 AGGCCTGCAGGGATGCACCGCGG + Intronic
1176027464 20:62993382-62993404 GGGGAGGCTGGGAGGCAGGGAGG + Intergenic
1176031951 20:63017072-63017094 CTGGCTGCCGGGAGGCAGCAAGG + Intergenic
1176107347 20:63395660-63395682 GGGGCTCCAAGGAGGAGGCGGGG + Intergenic
1176194943 20:63832416-63832438 GGGCCCGCAGGGAGGCAGGCTGG - Intergenic
1176255645 20:64151327-64151349 GGGGCTCCTGGCAGGGAGCGGGG + Intergenic
1177046893 21:16182535-16182557 AGGGATGGAGGGAGGCAGGGAGG - Intergenic
1177225248 21:18245118-18245140 GGCCCGGCAGGGAGGCAGGGAGG + Exonic
1177578537 21:22989561-22989583 GGAGGGGCAGGGAGGCAGTGGGG + Intergenic
1178582077 21:33845957-33845979 GGGGGTGCAGGCAGGCAGTGTGG + Intronic
1178742952 21:35220219-35220241 GGGCCTGTTGGGAGGCAGGGTGG + Intronic
1179046412 21:37849077-37849099 GAGACTGCAGGGAGGCACTGAGG + Intronic
1179658442 21:42860017-42860039 GGGGCTGCAGAGGGGCACAGAGG - Intronic
1179675067 21:42975186-42975208 GGGGCTGCTCGGAGGGTGCGGGG + Intronic
1179717498 21:43297442-43297464 GGGGCAACAGGGAGGCTGAGAGG - Intergenic
1179731353 21:43369463-43369485 GGGGCTGCAGGGTCGAGGCGTGG + Intergenic
1179907951 21:44433929-44433951 GGGGCTGGGTGGAGGCAGGGAGG + Intronic
1180042864 21:45288726-45288748 GGAGCTGCCTGGAGGCTGCGGGG - Intergenic
1180182731 21:46125097-46125119 GGGGGAGGAGGGTGGCAGCGAGG + Intronic
1180201436 21:46227198-46227220 GGGGCTGTAGGTGGGCAGAGTGG - Intronic
1180728483 22:17963547-17963569 GGGGTTGCATGGAGGCAGGATGG - Intronic
1180837291 22:18936243-18936265 GGGAATGCAGGGGCGCAGCGCGG + Exonic
1180853753 22:19033999-19034021 GGGGGGTCAGGGAGGCAGCCTGG + Intergenic
1180937807 22:19637605-19637627 GGGGCAGGAGGGAGTCAGCCTGG - Intergenic
1180974985 22:19843393-19843415 GGTGAGGCAGGGAGGCAGGGAGG + Intronic
1181028795 22:20140265-20140287 GGGGCTGCATGGGGACAGGGTGG + Intronic
1181031648 22:20150980-20151002 GGGGTTGCAGGGAGGGATGGAGG - Intergenic
1181085178 22:20436549-20436571 GGGGCTGCGAGGGGGCAGCGCGG - Intronic
1181262250 22:21606915-21606937 GAGGCTGCGGGCAGGCAGTGTGG - Intronic
1181496726 22:23291520-23291542 GGAGATGCAGGGATGCAGGGAGG - Intronic
1181540313 22:23569461-23569483 GGGTCAGCAGTGAGGCAGGGAGG + Intergenic
1181625175 22:24118239-24118261 TGGGCTGCAGGGGAGCAGGGAGG + Intronic
1181762467 22:25067677-25067699 GGGGCTGGAAGGAGGCAGACAGG - Intronic
1181801522 22:25350795-25350817 GGGGCTGAAGGGAGTCACGGTGG - Intergenic
1182098081 22:27639268-27639290 CGGGGTGCAGAGAGGCAGCAGGG - Intergenic
1182359649 22:29739062-29739084 TGAGGTGCAGGGAGGCAGTGAGG + Intronic
1182972100 22:34588871-34588893 GAGGCGGCAGGGAGGCGGAGGGG - Intergenic
1183063666 22:35349835-35349857 GGGGCTGCATGGGGGCTGGGGGG + Intergenic
1183299670 22:37052651-37052673 GGGCGGGCAGGGAGGCAGGGTGG - Intronic
1183360143 22:37379062-37379084 GGTGCTGCAGGGAGGAGGTGAGG + Intronic
1183414083 22:37672880-37672902 GGGCTGGCAGGGAGGCAGGGTGG - Intergenic
1183477931 22:38046291-38046313 GGGGCTACAGGGAGCCACGGAGG - Intergenic
1183603116 22:38851395-38851417 TGGGCTGCAGGGGGGCAGCAGGG + Intergenic
1183665758 22:39244899-39244921 GGAGCCCTAGGGAGGCAGCGGGG + Intergenic
1183713651 22:39521049-39521071 GCGGCGGCAGGGCGGCGGCGCGG + Exonic
1183730867 22:39617740-39617762 GGGGCAGCAGCTAGGCAGAGAGG - Intronic
1183829548 22:40410489-40410511 CTGGCTGCAGTGAGGCGGCGGGG + Exonic
1184103547 22:42354273-42354295 GTGGCTGCAGGGAAGTGGCGGGG - Intergenic
1184148748 22:42626623-42626645 GCAGCTGCGGGGAGGCAGGGTGG + Intronic
1184210980 22:43035440-43035462 GGGGCTGCAGGGCTGCTGCGGGG + Intergenic
1184220768 22:43098306-43098328 GGGGCAACAGGAAGGCAGGGTGG + Intergenic
1184248155 22:43246004-43246026 GGGGCTGCAGGGAGGCCTGAGGG + Intronic
1184301242 22:43562508-43562530 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301284 22:43562613-43562635 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301294 22:43562639-43562661 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301317 22:43562692-43562714 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301327 22:43562718-43562740 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184301350 22:43562771-43562793 GGGGTGGGAGGGAGGCAGCCTGG + Intronic
1184301360 22:43562797-43562819 GGGGTGGGAGGGAGGCAGCCCGG + Intronic
1184401390 22:44276644-44276666 GGAGATGGTGGGAGGCAGCGGGG + Intronic
1184431027 22:44441677-44441699 GGGGCAGCAGGGAGGGGGCTCGG - Intergenic
1184468687 22:44683578-44683600 GGGGCTGGGGGGAGCCAGCCAGG + Intronic
1184648557 22:45909118-45909140 GAAGCTGCAGGGGGGCAGCCAGG - Intergenic
1184648565 22:45909146-45909168 GAAGCTGCAGGGGGGCAGCCAGG - Intergenic
1184648573 22:45909174-45909196 GAAGCTGCAGGGGGGCAGCCAGG - Intergenic
1184783220 22:46659347-46659369 GAGGCTGGAGGGAGGCTGAGTGG - Intronic
1184857521 22:47154554-47154576 AGGGCTTCAGGGAGCCAGCCTGG - Intronic
1185009971 22:48307349-48307371 GGTGCTGCAGGAATGCAGAGCGG + Intergenic
1185269677 22:49923252-49923274 AGCGCTGCAGGGAGGCGGCTCGG - Exonic
1185332251 22:50257044-50257066 GAGGCTGCAGGGAGGCAGGCAGG - Intronic
1185336244 22:50271976-50271998 GGGCCTGCAGCGAGGCCGCGAGG - Intergenic
1203287384 22_KI270734v1_random:161542-161564 GGGAATGCAGGGGCGCAGCGCGG + Intergenic
949572234 3:5304655-5304677 AGGGATGCAGGGTGGCAGGGTGG + Intergenic
949925492 3:9037812-9037834 GGGGCTGCTGTGTGGCAGTGGGG - Intronic
950172523 3:10848942-10848964 TGGGCTGAAGGAAGGCAGCCTGG - Intronic
950421686 3:12903361-12903383 CGGGCAGCTGGGAGGAAGCGGGG - Intronic
950530157 3:13548685-13548707 GGGGCTGCAGGCAGGCCCCCAGG + Intergenic
950576996 3:13837970-13837992 GGGGCTGTTGCGGGGCAGCGTGG - Intronic
950683897 3:14602983-14603005 CGGGCCGCAGGGCGGCCGCGGGG - Intergenic
950694257 3:14685667-14685689 GGGACTGGAGGGTGGCAGCGGGG - Intronic
950702797 3:14761714-14761736 GGGGCTGAAGGGATGGAGTGGGG + Intronic
950841764 3:15974787-15974809 GGGGCTGGAGGGGGGAAGCAGGG - Intergenic
951376845 3:21928412-21928434 AGGGATGCAGGGAGGGAGAGAGG + Intronic
951565329 3:24007260-24007282 GAGGCTGCAGTGAGCCAGCCCGG + Intergenic
952537852 3:34332758-34332780 GGGGAGGCAGGGAGGGAGGGAGG - Intergenic
953265281 3:41380998-41381020 GGGGATGCATGGAGGAAGGGTGG - Intronic
953312379 3:41891336-41891358 GGGACTGGAGGGAGGGAGGGAGG + Intronic
953571937 3:44078176-44078198 GGGGCTGGAGGGAGGCAGTTAGG - Intergenic
953699898 3:45187425-45187447 GGGTCTGCAGGGAGGCAGGAGGG + Intergenic
953889805 3:46743363-46743385 GAGTCTGCAGGGAAGCAGCGCGG - Intronic
953904916 3:46863745-46863767 GGACCTGCAGAGAGGCAGCAGGG - Intronic
953905427 3:46866108-46866130 GGGGGTGGAGGGAGGGAGGGTGG + Intronic
954154492 3:48677914-48677936 AGGGCATCAGGGAGGCAGTGGGG - Intronic
954293295 3:49661005-49661027 GGGGCTGGAGGCTGGAAGCGGGG - Exonic
954716329 3:52528696-52528718 GGGGCGCCAGGGAGGCAGGACGG + Intronic
955049987 3:55400992-55401014 GGGACTGCTGGGAAGCAGCTTGG - Intergenic
955195728 3:56803141-56803163 GTGGCTGAAGGGAGGCACCTGGG + Intronic
955322073 3:57981671-57981693 GGGGGTGCAGGGTGGCTGCGGGG + Intergenic
957215761 3:77317741-77317763 GGGGCTGCTGGGGGGCTGCTGGG + Intronic
957215765 3:77317752-77317774 GGGGCTGCTGGGGGGCTGCTAGG + Intronic
957215790 3:77317810-77317832 GGGGCTGCTGGGGGGCTGCTGGG + Intronic
957215794 3:77317821-77317843 GGGGCTGCTGGGGGGCTGCTAGG + Intronic
957215804 3:77317843-77317865 GGGGCTGCTGGGGGGCTGCTGGG + Intronic
957215815 3:77317866-77317888 GGGGCTGCTGGGGGGCTGCTGGG + Intronic
957215819 3:77317877-77317899 GGGGCTGCTGGGGGGCTGCTAGG + Intronic
957780808 3:84815483-84815505 GGAACTGCAAGGTGGCAGCGAGG - Intergenic
958718800 3:97820940-97820962 AGGGCTTCTGGGAGGCAGCGTGG + Intergenic
959587227 3:108035981-108036003 GGGGGTGCAGGAAGGAAGTGGGG - Intergenic
959637758 3:108594417-108594439 GGGGGAGCAGGGAGGGAGGGGGG - Intronic
960281284 3:115784167-115784189 CGGCCTGCAGAGAGGGAGCGCGG - Intergenic
961003047 3:123386763-123386785 GGGGGCGCTGGCAGGCAGCGTGG - Intronic
961028826 3:123584835-123584857 GGGGAGGCGGGGAGCCAGCGCGG - Intronic
961201860 3:125051875-125051897 GGGGCTGCTGGAAGGCAGGAGGG + Intronic
961415678 3:126754906-126754928 GTGGCTGCAAGGAGGGAGTGTGG + Intronic
961445059 3:126976526-126976548 GGGGCTGCAGAGAGGCTTCCTGG + Intergenic
961473965 3:127135666-127135688 GGGGCCGCGGGGAGGGTGCGGGG - Intergenic
961645201 3:128389126-128389148 GAGGCTGGAGGGAGGCAGGCAGG + Intronic
961816786 3:129555258-129555280 GGGGCTGGAGGGGGGCAGCTGGG - Exonic
961825722 3:129598071-129598093 TGGGCTGCGGGGAGCCAGCAGGG - Intronic
962273313 3:133994058-133994080 GTGGCTGCAGGGAAGCATGGGGG + Intronic
962773359 3:138634403-138634425 AGGGTTGCAGGGCGGCAGCGTGG + Intergenic
963073614 3:141326402-141326424 GGGGTTGCAGGGGAGCAGGGTGG + Intronic
963514700 3:146293644-146293666 GGAACTGCAAGGCGGCAGCGAGG - Intergenic
966870989 3:184290620-184290642 GGGCCTGCAGGATGCCAGCGGGG - Exonic
966891499 3:184410450-184410472 GGAGCTGTAGGGGGTCAGCGGGG + Intronic
966911463 3:184562402-184562424 GGGGCTGCGGGCTAGCAGCGTGG + Intronic
967859609 3:194141309-194141331 GGGGTTCCAGGGAGGCCGCCCGG + Intergenic
967970240 3:194994148-194994170 GGGGCAGCTGGGAGGCAGCGAGG - Intergenic
968074684 3:195809946-195809968 GGGGCGCCGGGGAGGCAGCTTGG - Intronic
968114870 3:196081880-196081902 GGGGCGGCCGGGATGGAGCGGGG - Intronic
968235869 3:197029768-197029790 GGGGGAGCAGGGAGGAAGCCCGG - Exonic
968370285 3:198219607-198219629 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
968591520 4:1462146-1462168 GGGACTGGAGGGAGGCGGGGCGG - Intergenic
968611993 4:1561529-1561551 GGGGCTGCACAGAGGCTGGGTGG + Intergenic
968628630 4:1638953-1638975 GTGACTGCAGGGAGGGGGCGAGG + Intronic
968641439 4:1716931-1716953 GGGGCAGGAGGGAGGCAAAGAGG + Exonic
968699159 4:2046696-2046718 GAAGCTGCAGGGAGGCTGCCTGG + Intergenic
968716710 4:2165411-2165433 GGGGCTGGTGGGAGGGAGGGAGG + Intronic
968813887 4:2812012-2812034 GGCCCTGCGGGGAGGCAGCAGGG + Intronic
968976085 4:3822735-3822757 GTGGCTGCAGGGAGAGAGAGAGG - Intergenic
969235908 4:5864954-5864976 TGGGCTGGGGGGAGGCAGGGAGG + Intronic
969277438 4:6146224-6146246 GGGGCTGGGGGGAGGTTGCGGGG + Intronic
969520531 4:7675480-7675502 CGACCTGCAGGGAGGCACCGTGG - Intronic
969529954 4:7725146-7725168 GGGCCTGCAGGGGGGCTGTGGGG - Exonic
969530305 4:7726761-7726783 GGGGCTGCAGGGGCACAGCAGGG - Exonic
969584793 4:8085440-8085462 GGGGCTGCAGCGTGGGGGCGGGG - Intronic
969597838 4:8158904-8158926 GGTGCTCCCGGGCGGCAGCGGGG - Intergenic
969662300 4:8537457-8537479 GGGGCTGGAAGCAGGCAGCCTGG - Intergenic
969713415 4:8857438-8857460 GGCGCAGCAGGGAAGCCGCGGGG - Intronic
969715911 4:8868013-8868035 TGAGCTGCAGGGAGGCGGCCAGG + Exonic
970456190 4:16226479-16226501 GAGGCTGGAGGGAGGCGGCGGGG - Exonic
971013556 4:22464788-22464810 GGGACTGCTGGGAGCCAGCAAGG - Intronic
971405718 4:26319879-26319901 GGGGCTGCAGGTAGGAGGAGGGG + Exonic
972382833 4:38535389-38535411 GGGGCTGCAGGGAAGCTGAGTGG - Intergenic
973613650 4:52659228-52659250 GGGGAGGCCGGGCGGCAGCGCGG + Exonic
973694537 4:53477067-53477089 GGGATTGCAGGGATGCAGAGAGG + Intronic
973945338 4:55949145-55949167 GGCACTGCCGGGAGGCCGCGCGG + Intronic
975359516 4:73451558-73451580 GAGGCTGCAGGGATGCAGGATGG + Intronic
975549478 4:75596513-75596535 GGGGCTGCTGGGAGGCATGAGGG - Intronic
975985400 4:80197556-80197578 GGGGGTGGAGGGAGGGAGGGAGG - Intronic
976321789 4:83725185-83725207 GTGGCTGAAGGGAAGCAGAGAGG - Intergenic
976333338 4:83856971-83856993 GGGGCTCCAGTAAGGCAGCAGGG - Intergenic
976390135 4:84498085-84498107 GGGGGGGCCGGCAGGCAGCGGGG + Exonic
977151726 4:93520922-93520944 GGGGCTCAAGGGTGGGAGCGGGG + Intronic
977874737 4:102135646-102135668 GGGGCTGCAGAGGACCAGCGGGG - Intergenic
978012753 4:103707924-103707946 CGAGCTGCAAGGAGGCAGTGAGG + Intronic
978030517 4:103936630-103936652 GGAGGTGCCGGGAGCCAGCGAGG - Intergenic
978398236 4:108305292-108305314 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
978705103 4:111698472-111698494 GGGGAAGCAGGGAGGGAGGGAGG + Intergenic
978756607 4:112309466-112309488 CGAACTGCAGGGTGGCAGCGAGG - Intronic
979349681 4:119629029-119629051 GCGGCTGGAAGGAGGCCGCGCGG + Intergenic
979521142 4:121668405-121668427 GGTGCTGAAGGAAGGCAGTGGGG + Exonic
979526347 4:121721420-121721442 AGGGCTGTAGGGAGACAGCAAGG + Intergenic
980086291 4:128393651-128393673 CGGGCAGCAGGGAGGGAGAGCGG + Intergenic
980984479 4:139682471-139682493 GGGGCTGCAGGGAGCCTGGCAGG + Intronic
981067217 4:140498058-140498080 GGGGCTGCAGGAATGCAGGCGGG - Intronic
981205153 4:142032274-142032296 GGGGCAGCAGAGAGGTAGGGAGG + Intronic
981300832 4:143184786-143184808 GGGGGAGCAGGGAGGGAGAGAGG + Intergenic
983689409 4:170450414-170450436 TGGGAGGCAGGGTGGCAGCGGGG - Intergenic
984019571 4:174468610-174468632 GAGGCTGCAGGGAGGCACCCAGG + Intergenic
984946431 4:184972198-184972220 GGGGCTGGAGGGAGGGAGAGAGG - Intergenic
985192386 4:187389912-187389934 GCGGCTGCAGAGAGGCAGAAAGG + Intergenic
985451699 4:190066603-190066625 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985451702 4:190066611-190066633 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985452687 4:190069895-190069917 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985452690 4:190069903-190069925 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985453677 4:190073200-190073222 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985454663 4:190076485-190076507 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985454666 4:190076493-190076515 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985455655 4:190079786-190079808 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985456635 4:190083072-190083094 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985456638 4:190083080-190083102 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985457623 4:190086372-190086394 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985457626 4:190086380-190086402 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985458610 4:190089665-190089687 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985458613 4:190089673-190089695 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985459599 4:190092965-190092987 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985459602 4:190092973-190092995 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
985521826 5:377423-377445 GGGCTTGCAGGGAGGAGGCGGGG + Intronic
985614252 5:910159-910181 GGGGCTGCTGGGCTGCGGCGGGG - Intronic
985631636 5:1017158-1017180 GGGGCAGCAGGGAGGCCACCAGG - Intronic
985631758 5:1017674-1017696 GGGGCTGCAGGGCGGCCCCGTGG - Intronic
985710661 5:1426775-1426797 GGGGCTGCAGTGAGGGAGGATGG + Intronic
985822563 5:2170144-2170166 GGGGCTGCTGCGAGGCGGCCTGG - Intergenic
985824735 5:2183827-2183849 GGGCCTGCGGGGAGGCTGCTGGG + Intergenic
985996918 5:3602231-3602253 CGGGCAGCGGGGAGGCAGCTGGG + Intergenic
986437333 5:7747150-7747172 GGGGTAGCAGGGAGCCAGCATGG - Intronic
986690615 5:10310631-10310653 GGAGCTGCAGGGAGCCCGCTGGG + Intergenic
987771020 5:22305484-22305506 GTGGCTTCATGGAGCCAGCGTGG - Intronic
988360581 5:30231687-30231709 GGGGCTAAAGTGAGGCAGTGGGG - Intergenic
988999340 5:36744672-36744694 GGAGCTCCCGGGAAGCAGCGGGG - Intergenic
991054373 5:62306075-62306097 GGGGCCGCCTGGAGGCAGCGGGG + Intergenic
991275671 5:64843920-64843942 GGGGCTGCGGGGTGGCGGAGGGG - Intronic
991584204 5:68186160-68186182 GGGGCTGGCGGCAGGGAGCGTGG - Intergenic
992249941 5:74866491-74866513 GGGGCTGGAGGGAGGCAGGGCGG - Intronic
995244708 5:109922538-109922560 GGGGCTGGGGGGAGGCTGTGGGG + Intergenic
996009506 5:118465929-118465951 AGGGAGGCAGGGAGGCAGGGAGG + Intergenic
996119020 5:119650203-119650225 GGGGTAGCAGGGAGGCAGTGGGG - Intergenic
996166147 5:120226428-120226450 AGGGATGGAGGGAGGCAGAGAGG - Intergenic
997265067 5:132490596-132490618 GGGGCTGCAGTGAGGGCGCGCGG + Exonic
997299172 5:132789842-132789864 GGGGCTGGAGGCAGGGAGAGTGG - Intronic
997605158 5:135170061-135170083 GGGACTGCAGTGAGGCAATGTGG - Intronic
997844995 5:137278197-137278219 AGGGCTGCAAGGTGGCAGCTAGG - Intronic
998264801 5:140659892-140659914 GAGGGAGCAGGGAGGCAGGGGGG - Intronic
999185304 5:149703086-149703108 GGTGCTGGAGAGAGGCAGCCTGG - Intergenic
999233793 5:150078522-150078544 GGGCTTGGAGGGAGGCAGGGAGG - Intronic
999758552 5:154682950-154682972 GGAGCTGGAGGGAGGCGGAGGGG - Intergenic
999868603 5:155728194-155728216 GGGGCTGGAGGGAGGGAGCGAGG - Intergenic
1000052693 5:157575896-157575918 GGGGCTGGAGGGAGGGGCCGGGG + Intergenic
1001245946 5:170105983-170106005 GGGGCTGCAGCGAGGTGGGGAGG - Exonic
1001348829 5:170936013-170936035 GGAACTGCAAGGCGGCAGCGAGG - Intronic
1001396501 5:171422185-171422207 GGAGCTGGAGGGAGGGAGTGTGG + Intronic
1001633167 5:173191763-173191785 GGGGCCGCAGCGTGGCAGGGAGG - Intergenic
1001638305 5:173228311-173228333 GGGACTCCAGGGATGCAGCCCGG - Intergenic
1001688709 5:173616290-173616312 CGGGTCGCCGGGAGGCAGCGAGG + Exonic
1001734648 5:173988760-173988782 GGGGCTGGAGGGAGAAAGCTGGG - Intronic
1001917223 5:175571745-175571767 GGGGATGCAGGGAGGGATCCTGG + Intergenic
1002051442 5:176573906-176573928 GGGGGTGCGGGGCGGCAGAGAGG - Intronic
1002069889 5:176672872-176672894 GGGGCTTCAGGGAGCCAGGAGGG + Intergenic
1002163737 5:177332299-177332321 GGGGCTGCAGGAGGGCAGTGGGG + Intronic
1002194457 5:177494678-177494700 GTGGCTGGAGAGAGGCAGGGAGG + Intronic
1002195088 5:177497089-177497111 GAGGCTGCTGGGAGCCAGGGCGG + Intronic
1002337553 5:178490432-178490454 GGTGCTGAAGGGAGGACGCGTGG + Intronic
1002340733 5:178515263-178515285 GAGGCTGCAGGGAGGGAGGCTGG - Intronic
1002401750 5:178994957-178994979 CGGGCTGCGGGGAGACAGAGGGG + Exonic
1002594322 5:180312196-180312218 GGGGAGGCAGGGAGGCAGGGAGG + Intronic
1002594325 5:180312204-180312226 AGGGAGGCAGGGAGGCAGGGAGG + Intronic
1002594326 5:180312212-180312234 AGGGAGGCAGGGAGGCAGCGCGG + Intronic
1002721660 5:181265139-181265161 GAAGACGCAGGGAGGCAGCGTGG - Intergenic
1002729817 5:181326367-181326389 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1002947917 6:1780505-1780527 GGTGCTGCAGACAGGCAGAGAGG - Intronic
1003106549 6:3220995-3221017 GGGGAGGCAGGAAGGCAGGGTGG + Intergenic
1003141185 6:3472543-3472565 CGGTTTGCAGGGAGGCAGCATGG - Intergenic
1003513105 6:6797796-6797818 TGGGGCGCAGGGAGGCAGCAAGG - Intergenic
1003567054 6:7230673-7230695 GGGGTTCCAGGAAGGCAGTGAGG - Exonic
1003869363 6:10390081-10390103 AGGGCTGATGGGAGCCAGCGAGG + Intergenic
1004113973 6:12749288-12749310 GGGGCTGCAGGCGGGAGGCGGGG + Intronic
1004469921 6:15920179-15920201 GGAGCTGCAGGGAGGAAGCCGGG + Intergenic
1004865641 6:19851466-19851488 GGGACTTCAGGGAGGCTGGGGGG - Intergenic
1005906303 6:30263802-30263824 AGGGATGCAGGGAGGAAGGGAGG + Intergenic
1006099413 6:31676834-31676856 GTGGCTGGAGGGAGGCAAGGAGG + Exonic
1006116226 6:31777432-31777454 GGGGCTGCAGGGTGGGAGTGAGG - Intergenic
1006378407 6:33684301-33684323 GTAGCTGGAGGGAGGCAGTGTGG + Intronic
1006404670 6:33838015-33838037 GGAGCTGCAGGGAGGCCTGGGGG + Intergenic
1006432612 6:34007221-34007243 GTGGCTGCAGGGATGCGGGGTGG + Intergenic
1006437327 6:34032847-34032869 TGGGCTGCTGGCAGGCAGCCAGG + Intronic
1006615285 6:35321808-35321830 GGGGCTTGAGGGAGGAAGGGAGG - Intergenic
1006920847 6:37626174-37626196 GGGCCTGCAGGGAGGAGGGGAGG - Intergenic
1007112383 6:39320375-39320397 AGGGCTGCAGGCTGGCAGTGGGG - Intronic
1008621562 6:53276501-53276523 GGTTCTGCAGAGAAGCAGCGTGG - Intronic
1010000532 6:70944488-70944510 GCGACTGCAAGGCGGCAGCGAGG + Intronic
1010428070 6:75748766-75748788 TGGGCGGCAGCGAGGCTGCGTGG - Intergenic
1011492480 6:87906658-87906680 GTGGCTGCAGGGAAGCACCTTGG + Intergenic
1011664818 6:89623572-89623594 GGGGTGGCTGGGAGGCAGGGTGG + Intronic
1011999621 6:93637181-93637203 CCAGCTGCAGGGCGGCAGCGAGG - Intergenic
1012410263 6:98948050-98948072 GGGCCTGGAGGGAGGCGGGGCGG + Intergenic
1012550961 6:100464572-100464594 GGGGCTGCTGGGCGGGCGCGGGG + Intronic
1013300229 6:108798355-108798377 AGGGCTGCGAGGAGGCAGCATGG - Intergenic
1013538258 6:111083259-111083281 GGGTCTGCAGGGAGGAATAGAGG + Intergenic
1013571954 6:111436634-111436656 GGGGGTGCAGGGATGAAGAGAGG + Intronic
1013787182 6:113794972-113794994 GGGGCGGCAAGCAGGCAGTGTGG - Intergenic
1014164483 6:118208164-118208186 GGGCCTGCATGCAGGCAGCGGGG - Intronic
1014357692 6:120432995-120433017 GGATCTGCAGGGCGGCAGCGAGG + Intergenic
1016904842 6:149138153-149138175 AGCACTGCAGGGAGGCAGCAGGG + Intergenic
1016954798 6:149616054-149616076 GGGGCTGCAGGGAGGGTGAATGG + Intronic
1016965829 6:149717972-149717994 GGGGCTGCCGCGGGCCAGCGCGG + Exonic
1017048040 6:150365399-150365421 GGGGATGCAGGAAGCCAGAGAGG - Intergenic
1017381141 6:153831573-153831595 GGTGCTGGAGGGAGACAGAGAGG + Intergenic
1017461394 6:154654474-154654496 GGGGCTGCAGAGAGGAAGTTAGG - Intergenic
1017717277 6:157221935-157221957 CAGGCAGCAGGGAGGCAGTGAGG - Intergenic
1017729945 6:157306269-157306291 AGGGCTGCAGAGAGGCAAGGCGG + Intronic
1018375005 6:163202083-163202105 GGGGCAGCAGGAGGGCAGCAGGG + Intronic
1018924207 6:168195113-168195135 GGGGCTGCAGGGATGCCACATGG - Intergenic
1018941074 6:168309045-168309067 GGGGCTCCAGAAAGCCAGCGCGG - Exonic
1018945648 6:168345709-168345731 GGGGCAGCCGGGGGGCAGCTGGG + Intergenic
1018945663 6:168345741-168345763 GGGGCAGCCGGGGGGCAGCTGGG + Intergenic
1018978197 6:168581772-168581794 GGGGCTGCAGGGAGGCAGCGGGG - Intronic
1019149489 6:169994535-169994557 GCGTCTGCAGGGAGCCAGCAGGG - Intergenic
1019209853 6:170396324-170396346 GAGTCTGCATGGAGGCTGCGGGG + Intronic
1019413070 7:914993-915015 CCGGCTGCAGGGAGGCTGCTGGG - Intronic
1019414355 7:920499-920521 GGGGGTGCAAGGTGGCAGCACGG - Intronic
1019451441 7:1100723-1100745 CGGGAGGCAGGGAGGCAGAGGGG - Intronic
1019475559 7:1242480-1242502 CGGGCTGCGGGGAGCGAGCGCGG + Intergenic
1019477277 7:1249953-1249975 AGGGACGGAGGGAGGCAGCGCGG + Intergenic
1019491159 7:1314264-1314286 GGGGCTGCAGGGAACCTGAGTGG - Intergenic
1019516508 7:1442553-1442575 TGAGCTGCAGGGAGGCAGAGGGG - Intronic
1019516554 7:1442689-1442711 CGAGCTGCAGGGAGGCAGAGGGG - Intronic
1019517349 7:1445895-1445917 CGGGGTGCAGGGTGGCAGCAAGG + Intronic
1019623912 7:2006029-2006051 GGAGCGGCAGGGAGGCAGGAGGG + Intronic
1019774964 7:2906860-2906882 GGGGCTGTGGGGAGGCTGCAAGG + Intronic
1019817802 7:3213934-3213956 CAGGCTCCTGGGAGGCAGCGTGG - Intergenic
1019928260 7:4207215-4207237 GAGGCTTCGGGGAGGCAGCCTGG - Intronic
1020212237 7:6165692-6165714 GGGACTGCTGGGAGGCGGCAAGG + Intronic
1020278331 7:6637569-6637591 GAGGCCGCGGGGAGGCGGCGGGG + Intronic
1020283628 7:6664054-6664076 GGGGCTGCAGAGCGGGCGCGGGG + Intergenic
1020876291 7:13698914-13698936 GGGACTCCAGGGAGGGAGGGAGG + Intergenic
1021731215 7:23597371-23597393 GGGCCGGCAGGGAGGCGGAGCGG + Exonic
1022040150 7:26573438-26573460 GTGTCTGCAGGTAGGCAGCCTGG + Intergenic
1022088145 7:27088437-27088459 GGGGCTGCGGGGAGCGGGCGGGG - Intergenic
1022256262 7:28661433-28661455 TGGGCTCCAGGGAGCCAGAGGGG - Intronic
1023842377 7:44104626-44104648 GGGGCTCCGGGGAGGGCGCGGGG - Exonic
1023940382 7:44765521-44765543 GGGGCTGCAGGGGGGCAAAGGGG - Exonic
1023986802 7:45101708-45101730 GGAGCTGCAGGGTGTCAGCCTGG - Intronic
1024026765 7:45416218-45416240 GGGGCAGCAGGGAGCCAGTTGGG - Intergenic
1024074485 7:45811620-45811642 CGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1024074816 7:45812978-45813000 CGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1024260934 7:47573363-47573385 CGGGCTGGTGGGAGGCAGCGTGG - Intronic
1024648591 7:51387627-51387649 CGGGCTGCCGGGAGGCAGGCAGG + Intergenic
1024996792 7:55278429-55278451 GGGTCTGCATGGAGACAGCCTGG - Intergenic
1025052538 7:55742451-55742473 CGGGCTGCCGGGAGGCAGGCAGG + Intergenic
1025052923 7:55743908-55743930 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025106352 7:56174776-56174798 ACGGCTGCAGGGAGCCAGGGCGG + Intergenic
1025129826 7:56369458-56369480 CGGGCTGCCGGGAGGCAGGCAGG + Intergenic
1025175966 7:56802603-56802625 GAGGCTGCCGGGAGGCAGGCAGG + Intergenic
1025176153 7:56803472-56803494 AGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1025176429 7:56804552-56804574 CGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1025192331 7:56905340-56905362 GTGCCTGCTGGGAAGCAGCGAGG - Intergenic
1025284977 7:57653712-57653734 GCGGTTGCATGGCGGCAGCGAGG + Intergenic
1025689125 7:63744805-63744827 GAGGCTGCTGGGAGGCAGGTAGG - Intergenic
1025695640 7:63772950-63772972 AGGGCTGCCGGGAGGCAGGCAGG - Intergenic
1025695827 7:63773819-63773841 GAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025752692 7:64307224-64307246 AGGGCGGCAGGGCGGCAGGGCGG - Intergenic
1025792360 7:64701325-64701347 GGGGTTGCAGTGAGCCAGCCTGG - Intronic
1025912675 7:65840689-65840711 GAGGCTGCTGGGAGGCAGGCGGG - Intergenic
1026319333 7:69255318-69255340 GAGGCTGCAGGGAGGCTTAGAGG + Intergenic
1026817200 7:73522145-73522167 GGGGCTGCTGGGAGGCGCGGCGG - Exonic
1027130452 7:75586691-75586713 GGGGCTGAAGGGATGGAGCAGGG + Intronic
1027152549 7:75742763-75742785 GGCGTGGCAGGGAGGCAGCTGGG + Intergenic
1029416126 7:100444374-100444396 AGGGCTGCGAGGAGGCAGAGAGG - Intergenic
1029421139 7:100472414-100472436 TGGGATGGAGGGAGGCAGGGAGG + Intronic
1029493868 7:100886869-100886891 GGAGCTGCTGGGGAGCAGCGGGG + Exonic
1029665531 7:101992777-101992799 GGGGTTGGAGGGGGGCGGCGGGG - Intronic
1029708154 7:102286265-102286287 AGGGCTGCAGGGAGGGGGCGTGG + Intronic
1029745027 7:102512005-102512027 GGGGCTGGAGGGCGGGATCGGGG + Intronic
1029763019 7:102611166-102611188 GGGGCTGGAGGGCGGGATCGGGG + Intronic
1030304219 7:108002882-108002904 GTGGCTGCAGGGAGCCGGCATGG - Exonic
1030354424 7:108526537-108526559 GGGGCTTCAGGGACGCGGAGAGG - Intronic
1030980669 7:116182074-116182096 GGGGGTGGGGGGAGGCAGGGAGG + Intergenic
1031075606 7:117209274-117209296 GGTGCTACAGGGAGGAAGGGTGG - Intronic
1031088422 7:117324674-117324696 GGAGGTGCAGGGAGGGCGCGTGG + Intergenic
1031146659 7:118004305-118004327 GGCACTTCAGGGAGGCAGGGAGG - Intergenic
1031317286 7:120273403-120273425 GGGGCTGCGGGGCGGCCGGGCGG - Intergenic
1031410845 7:121438676-121438698 GGAACTGCAAGGCGGCAGCGAGG - Intergenic
1031523300 7:122793151-122793173 GGGGCTGGAGGGATGCACCAAGG - Intronic
1032013550 7:128361600-128361622 GGCGCCGCTGGGAGGGAGCGCGG - Exonic
1032051533 7:128653488-128653510 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1032500845 7:132398587-132398609 TGGGCTCCAGGGACGCAGGGAGG + Intronic
1033685472 7:143636536-143636558 GGGGAAGCAGGGAGGGAGGGAGG - Intronic
1033688642 7:143715754-143715776 GGGGAAGCAGGGAGGGAGGGAGG - Intronic
1033699142 7:143821084-143821106 GGGGAAGCAGGGAGGGAGGGAGG + Intergenic
1034228019 7:149497781-149497803 GAGGCTTCCTGGAGGCAGCGCGG + Exonic
1034264841 7:149775917-149775939 TGGGCTGCGGGGAGGCTGCGTGG + Intergenic
1034266417 7:149783249-149783271 GGTGGTGCAGGGAGACAGCAGGG - Intergenic
1034345559 7:150383490-150383512 TGGGCTGCAGGAGGGCAGGGAGG + Intronic
1034876653 7:154730302-154730324 GGAGCTGCAGGGACCCAGGGAGG + Intronic
1034983109 7:155490935-155490957 GGTGCTGCAGGGGGGCAGAGGGG - Intronic
1035060633 7:156066759-156066781 AGGCATGCAGAGAGGCAGCGAGG + Intergenic
1035297598 7:157875981-157876003 GGGGCTGCAGAGGGTCAGCAGGG + Intronic
1035375336 7:158403644-158403666 TGGGCAGCAGGCAGGCAGTGCGG + Intronic
1035404198 7:158587599-158587621 GGGGCGGCAGGCAGGACGCGTGG + Exonic
1035563675 8:627642-627664 GGTGGTGCAGGGAGGCACCCCGG - Intronic
1035677745 8:1467245-1467267 GGGGCTGGGGGGAGGGACCGTGG - Intergenic
1035743361 8:1945078-1945100 CAGGCTGCAGGCAGGCAGTGGGG + Intronic
1035811311 8:2493700-2493722 GGGTCAGCAGGAAGGCACCGTGG - Intergenic
1036105180 8:5830438-5830460 GCTGCTGCAGTGAGGCAGTGGGG + Intergenic
1036282759 8:7415752-7415774 AGGGAGGCAGGGAGGCAGGGAGG - Intronic
1036282762 8:7415760-7415782 GGGGAGGCAGGGAGGCAGGGAGG - Intronic
1036338704 8:7895767-7895789 GGGGAGGCAGGGAGGCAGGGAGG + Intronic
1036552099 8:9824960-9824982 GGGGCTGCAGGGAGGAAGATGGG + Intergenic
1037889138 8:22614073-22614095 GGGGCTACAGGAAGACAGCAAGG - Exonic
1037901731 8:22692757-22692779 GGGGAGGCGGCGAGGCAGCGAGG - Intronic
1037901732 8:22692765-22692787 AGGGCGGCGGGGAGGCGGCGAGG - Intronic
1038016940 8:23523415-23523437 GGGGTTGCAGGGAGGGAGGAAGG + Intergenic
1038542476 8:28401817-28401839 GGGGCGGGAGGGAGGGAGGGAGG - Intronic
1039480127 8:37866916-37866938 TGTGTTGCAGGCAGGCAGCGGGG + Intronic
1039639630 8:39205345-39205367 GGAACTGCAAGGTGGCAGCGAGG - Intronic
1039880108 8:41620307-41620329 GCTGCTGCAGGGAGGCACGGGGG + Intronic
1039880475 8:41622297-41622319 AGGGCTGCAGAGGGGCAGGGTGG + Exonic
1039884931 8:41649382-41649404 GGCTCTGCTGGGAGGCAGGGAGG - Intronic
1040017205 8:42709251-42709273 GGCTCTGCAGGGAGACAGGGTGG + Intronic
1040287086 8:46105961-46105983 CGGGCTGCAGGGACTCAGCGTGG - Intergenic
1040295947 8:46149159-46149181 GGGGCCGCAGGGCTGCAGGGTGG - Intergenic
1040313825 8:46250498-46250520 CGGGCTGCAGGGATTCAGTGGGG + Intergenic
1040825316 8:51613488-51613510 GGGGGGGCAGGGCGGCAGAGGGG + Intronic
1042217250 8:66438885-66438907 GGGGGTGTAGGGAGGAAGCAAGG + Intronic
1042801552 8:72723527-72723549 GGGGCTCCAGGGAGGCCAAGAGG - Intronic
1042930491 8:74008553-74008575 GGGCCTACATGAAGGCAGCGCGG + Intronic
1043039260 8:75240428-75240450 GGTTCTGCAGGGAGACAGAGGGG - Intergenic
1045571341 8:103371671-103371693 GCCGCTGCGGGGAGGCGGCGGGG - Exonic
1046293632 8:112194497-112194519 GGGGCTGCAGGGAAGAATCAGGG - Intergenic
1046620625 8:116525904-116525926 GAGGCAGCTGGGAGGCAGCCAGG + Intergenic
1046841895 8:118868300-118868322 GGAAATGCAGGGAGGCAGAGGGG - Intergenic
1048512305 8:135073759-135073781 GGGGCTGCAGGAAGGCTCAGTGG - Intergenic
1048927491 8:139284063-139284085 AGAGGTGCAGGGCGGCAGCGTGG - Intergenic
1048959360 8:139563130-139563152 AGGGATGGAGGGAGGCAGCCAGG - Intergenic
1048984952 8:139730324-139730346 GCAGATGCAGGGAGGCAGGGAGG + Exonic
1049262123 8:141645521-141645543 TAGGCTGCAGGGAGGGAGTGGGG - Intergenic
1049262317 8:141646355-141646377 GGGGGTGCCGAGAGGCAGGGGGG - Intergenic
1049263442 8:141652347-141652369 GGGGTTAGAGGGAGGCAGAGTGG - Intergenic
1049308765 8:141922300-141922322 GGGCCTGCTGGAAGGCAGGGCGG + Intergenic
1049379910 8:142306936-142306958 GGTGCTGGAGGGAGGCCCCGGGG - Intronic
1049386545 8:142345635-142345657 GGAGCTGCAGGGAGGAGGCTGGG - Intronic
1049541396 8:143210761-143210783 GGGGCTTGAGGGAGGCTGCGTGG + Intergenic
1049548883 8:143247201-143247223 CGGGGTGCGGGGAGGCGGCGGGG - Exonic
1049551872 8:143263814-143263836 GGGTCTGCAGGGAGGGAGGGAGG - Intronic
1049587440 8:143438589-143438611 GGGCCTGGAGGCAGGCAGTGTGG + Intronic
1049676484 8:143891512-143891534 GGGGCTGCAGGAAAGCAACCTGG + Intergenic
1049739042 8:144226515-144226537 GAGGCTGCAGTGAGCCAGCATGG - Intronic
1049803817 8:144530074-144530096 GGAGCCACAGGGAGGCAGCCCGG + Exonic
1049861626 8:144902451-144902473 GGGGCTGCGTGGGGGCGGCGGGG + Intergenic
1049927137 9:420382-420404 AGGGCTGAAGGGAGGCAGATTGG - Exonic
1049929881 9:446165-446187 GGGGCTGCAAGGAGGGAGAGGGG - Intronic
1049944310 9:579654-579676 GTGGGTGCAGGGAGGCAGTATGG + Intronic
1050041648 9:1501603-1501625 GGGGCAGCGGGGGGGAAGCGGGG - Intergenic
1050094340 9:2047636-2047658 GGTGCTGAGGGGAGGCACCGGGG + Intronic
1051228199 9:14925007-14925029 GGGACTGGTGGGAGGCAGAGAGG + Intergenic
1051287769 9:15513622-15513644 GGTGGGGCAGGGAGGCAGCAAGG + Intergenic
1051800950 9:20933350-20933372 GGGGATTCAGGGAGAAAGCGTGG - Intronic
1051886192 9:21895732-21895754 GGAACTGCAAGGCGGCAGCGAGG + Intronic
1052820185 9:33132269-33132291 GGGAAAGCAGGGAGGCAGCTGGG + Intronic
1052900658 9:33791952-33791974 GGGGCAGGAGGCAGGCAGGGAGG + Intronic
1053094961 9:35318386-35318408 GGGGTGGCGGGGCGGCAGCGGGG - Intronic
1056396580 9:86186837-86186859 TGGGCTGCATGGGGGCAGGGTGG + Intergenic
1056678068 9:88693245-88693267 GGCTCTGCTGGGAGGCAGCAGGG - Intergenic
1056967802 9:91179136-91179158 GGGGCTGCAGGGAGTCATCAGGG + Intergenic
1056968380 9:91182995-91183017 GGAGCAGGAGGGAGGCAGAGTGG - Intergenic
1057057187 9:91972499-91972521 GGGGCTGAATGGAGGGAGCCAGG + Intergenic
1057181809 9:93034660-93034682 GCACCTGCAGGGAGGCAGCCAGG + Exonic
1057259416 9:93575907-93575929 GGGAACGGAGGGAGGCAGCGCGG + Intergenic
1057264345 9:93604092-93604114 GGGAGTGCAGGGAGGCACAGAGG + Intronic
1057312777 9:93952307-93952329 GGTGCTGCAGGGCGGCGGCCTGG - Exonic
1057667985 9:97061464-97061486 TGGGCAGCAGGGAGGGAGGGAGG + Intergenic
1058058613 9:100473441-100473463 GCGGCTGCTAGGAGGCACCGAGG + Exonic
1059310991 9:113389103-113389125 GGTGCTGCAGGGAAGCAGACAGG + Exonic
1059883242 9:118715569-118715591 GGGGGGGCAGGGAGGAAGAGAGG - Intergenic
1060058262 9:120434660-120434682 GGGGCTGCACAGAGGCAGCCAGG + Intronic
1060280622 9:122213555-122213577 GGGCCTGCGGGGAGGGGGCGCGG - Intronic
1060408998 9:123387658-123387680 GGGGCTGCATGGCGAAAGCGGGG - Intronic
1060434889 9:123584843-123584865 GGGGAGGCAGGCAGGCAGAGAGG - Intronic
1060483405 9:124031194-124031216 GTGGGTGGAGGTAGGCAGCGTGG - Intronic
1060523495 9:124307822-124307844 GGGGCTGCAGTGAGGCGGTGGGG - Intronic
1060549863 9:124479803-124479825 GGGGCAGCAAGGAGGCAGGCAGG + Intergenic
1060822041 9:126666824-126666846 GGGCCTGCAGAGGGGCGGCGTGG + Intronic
1060985793 9:127818293-127818315 GGGGCCTGAGGGAGGCACCGTGG - Exonic
1061169145 9:128941890-128941912 GGGGCAGTAGGGAGGCAGAGAGG - Exonic
1061299094 9:129694560-129694582 TGCTCGGCAGGGAGGCAGCGCGG + Intronic
1061402961 9:130378399-130378421 GGGGAGGCAGGGAGGCTGGGAGG + Intronic
1061403039 9:130378590-130378612 GGGGAGGCGGGGAGGCAGGGAGG + Intronic
1061701923 9:132422624-132422646 GGGGCTGCAGTGAAGCAGCAGGG + Intronic
1061949866 9:133930223-133930245 GAGGATGCCGGGAGGCAGAGAGG - Intronic
1061949893 9:133930319-133930341 AAGGCTGCTGGGAGGCAGTGTGG - Intronic
1061949903 9:133930366-133930388 GAGGCAGCAAGGAGGCAGGGAGG - Intronic
1061977294 9:134075870-134075892 GGGGCGGCAGCCAGGCAGAGGGG - Intergenic
1062014931 9:134286630-134286652 GGGGCTGCAGGAAGCCTGGGGGG - Intergenic
1062074195 9:134575605-134575627 GAGGCTGCAGGGAGGCACCCAGG - Intergenic
1062143209 9:134971644-134971666 TGGGCTGCAGGGAAGCTGCCAGG - Intergenic
1062192783 9:135256339-135256361 TGGGGAGCAGGGGGGCAGCGAGG - Intergenic
1062318514 9:135979437-135979459 GCGGCTGCAGGGAGGAGGAGAGG + Intergenic
1062380970 9:136286300-136286322 GGGGCGGCAGGTAGGCTGTGGGG + Exonic
1062402506 9:136378684-136378706 GGGGCTGCGGGGAGAAAGGGTGG + Exonic
1062507890 9:136887158-136887180 GGGGCAGCAAGGAGCCAGTGCGG + Intronic
1062569793 9:137179782-137179804 GTCACTGCAGGGAGGCAGCTAGG - Intronic
1062687246 9:137820138-137820160 GTGGCTGCAGGGACGGAGCCTGG - Intronic
1062754229 9:138278879-138278901 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1203577789 Un_KI270745v1:21636-21658 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1185524552 X:766868-766890 GAGGCTGCAGTGAGGCAGCCAGG + Intergenic
1185778807 X:2828838-2828860 GGGGCTGCAGGGAGGAGGAGAGG + Exonic
1186496452 X:10015545-10015567 GGGGCGGCCGGGCGGCGGCGGGG + Exonic
1186806638 X:13146487-13146509 TGGGCTGCAGGGAGGTAGGGAGG - Intergenic
1189204041 X:39222459-39222481 GCAGCTGCAGGGAGGGAGAGGGG - Intergenic
1189240315 X:39519698-39519720 GGGGAGGGAGGGAGGCAGCGTGG - Intergenic
1189333072 X:40154778-40154800 GCAGCAGCAGGGACGCAGCGTGG + Intronic
1190715197 X:53097066-53097088 GGGGTTGCAGTGAGCCAGCCTGG + Intergenic
1191855270 X:65620306-65620328 GGAGCTGCGGGGCGGCAGCGAGG - Intronic
1192340572 X:70260099-70260121 TGGGCTGTAGGCAGGCAGTGGGG - Intergenic
1192546510 X:72018765-72018787 GGCGCTGCAGTGCGGCTGCGGGG + Intergenic
1192784789 X:74325256-74325278 GGGGCTCCAGGCAGGCAGGTTGG + Intergenic
1192803835 X:74493064-74493086 GGGGCTCCAGGCAGGCAGGTTGG - Intronic
1196888577 X:120270798-120270820 GGGTCTGCAGGGAGGCCCGGGGG - Intronic
1196901768 X:120390790-120390812 TGAGCTGCAAGGCGGCAGCGAGG - Intergenic
1198203630 X:134445801-134445823 AGGGGTGCAGGGAGGGGGCGGGG + Intergenic
1198424119 X:136497539-136497561 GGGACTGCTGGGGCGCAGCGGGG + Intronic
1199291954 X:146114313-146114335 GGGGCTCCAGGGATGTAGTGAGG + Intergenic
1199767837 X:150953730-150953752 GACCCTGCAGGGAGGCAGCTGGG - Intergenic
1200075591 X:153549110-153549132 GGAGGGGCTGGGAGGCAGCGGGG + Intronic
1200214276 X:154360548-154360570 GGGGCTGCAGGGAGGCAGTGCGG - Exonic
1200284362 X:154805778-154805800 GGGATTGCAGGGAGGCAACAAGG + Intronic
1200919585 Y:8601392-8601414 CAGGATGAAGGGAGGCAGCGAGG + Intergenic
1200985040 Y:9295115-9295137 GAGGATGAAGGGAGGCAGTGAGG - Intergenic
1201180038 Y:11334107-11334129 GGGGCAGCTGGGAGGCTGCAGGG - Intergenic
1202202210 Y:22365474-22365496 GGGGCGGCAGGGAGAGAGAGAGG + Intronic
1202380884 Y:24276087-24276109 CGGGCTGCTGGGAGGCAGGCAGG + Intergenic
1202489900 Y:25394038-25394060 CGGGCTGCTGGGAGGCAGGCAGG - Intergenic