ID: 1018978388

View in Genome Browser
Species Human (GRCh38)
Location 6:168582818-168582840
Sequence CACGCACGGGGAAGACCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018978380_1018978388 29 Left 1018978380 6:168582766-168582788 CCGGGAACTCAGAGCTTAGTAAC 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1018978388 6:168582818-168582840 CACGCACGGGGAAGACCCGGGGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018978388 Original CRISPR CACGCACGGGGAAGACCCGG GGG Intronic
902332692 1:15738315-15738337 TCCACACGGGGAAGACCAGGGGG + Intronic
902694244 1:18129541-18129563 CACCCACGGGCAAGACTCAGAGG + Intronic
914730513 1:150365465-150365487 CAGGTACAGGGAAAACCCGGTGG - Intronic
924800810 1:247328842-247328864 CAAGCACTGTGAAGACCCTGTGG - Exonic
1071333758 10:84585413-84585435 AAGGCACAGGGAAGACCCTGGGG + Intergenic
1075969868 10:126643307-126643329 CAGGAATGGGGAAGACCCTGTGG - Intronic
1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG + Exonic
1077187255 11:1240858-1240880 CACACACGGTGGAGACCGGGAGG - Exonic
1077334986 11:1999268-1999290 CAGGCACGGGGAACACCTGTGGG + Intergenic
1083753633 11:64777858-64777880 CGCGCACGGGGAGGCCCGGGCGG - Intronic
1087996377 11:104814393-104814415 CACTCACGGGGAAAACCAGCAGG + Intergenic
1202817969 11_KI270721v1_random:54450-54472 CAGGCACGGGGAACACCTGTGGG + Intergenic
1095796954 12:46230254-46230276 CAGGCACTGGGGAGACACGGGGG + Intronic
1096615908 12:52833587-52833609 CAGGCACGGTGAAGACCTGAAGG + Intronic
1104070342 12:125339353-125339375 CACACACAGGGAAGACCATGTGG - Intronic
1107014200 13:35695662-35695684 CACCCACGGGGAGGCCCAGGTGG - Intergenic
1111975995 13:94967940-94967962 GACGCACGGGGCAGCCGCGGAGG + Intergenic
1125038606 15:35156741-35156763 CATGCACAGGAAAGACCCAGTGG + Intergenic
1132678785 16:1131307-1131329 CAGGCCTGGGGAAGACCCGAGGG - Intergenic
1132889197 16:2195943-2195965 CACGCACCGGGAAGACAGGGAGG - Intronic
1133006217 16:2883179-2883201 GCCGCACGGGCAAGACGCGGAGG + Exonic
1133335353 16:5003543-5003565 AGAGCACGGGGAAGACTCGGGGG - Exonic
1135199320 16:20423190-20423212 CACTGAAGGGGAAGACCAGGAGG + Intronic
1135219378 16:20600453-20600475 CACTGAAGGGGAAGACCAGGAGG - Intergenic
1142132554 16:88437580-88437602 CGTGCTCGGGGTAGACCCGGGGG - Exonic
1145309138 17:21692002-21692024 CACGAACAGGGGAGACCTGGAGG - Intergenic
1150211911 17:63446390-63446412 CACGTGCGGGGCAGCCCCGGGGG - Intergenic
1152387233 17:79981889-79981911 TGCGCACAGGGAAGCCCCGGAGG - Intronic
1152613986 17:81329603-81329625 GACAAACGGGAAAGACCCGGCGG - Intronic
1160508298 18:79439371-79439393 CACGCACGGGGAGGACGCCGTGG + Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
948659616 2:239498973-239498995 CACGGAGGGGGATGACACGGGGG + Intergenic
1173392806 20:42649912-42649934 CAGGCAAGGGGAAGACAAGGAGG + Intronic
1175754791 20:61522653-61522675 CACGCACGGCGCAGTCCGGGTGG + Intronic
1176312319 21:5158703-5158725 CAAGCACGGGGACGACCAGCCGG - Intergenic
1177567938 21:22847782-22847804 CAGGCAAGGGGAAGACTCTGTGG + Intergenic
1179534364 21:42041893-42041915 CAGGCAGGGGGCAGCCCCGGGGG - Intergenic
1179844729 21:44103327-44103349 CAAGCACGGGGACGACCAGCCGG + Exonic
1179916521 21:44481469-44481491 CATGCACGGGAGAGACCAGGTGG - Intergenic
1179916539 21:44481531-44481553 CATGCACGGGAGAGACCAGGTGG - Intergenic
1179916557 21:44481593-44481615 CATGCACGGGAGAGACCAGGTGG - Intergenic
1179916575 21:44481655-44481677 CATGCACGGGAGAGACCAGGTGG - Intergenic
1179916607 21:44481779-44481801 CATGCACGGGAGAGACCAGGTGG - Intergenic
1179916623 21:44481841-44481863 CATGCACGGGAGAGACCAGGTGG - Intergenic
1179916639 21:44481903-44481925 CATGCACGGGAGAGACCAGGTGG - Intergenic
1179916657 21:44481965-44481987 CATGCACGGGAGAGACCAGGTGG - Intergenic
1179916676 21:44482027-44482049 CATGCACGGGAGAGACCAGGTGG - Intergenic
1181129395 22:20721511-20721533 CAGGCAAGGGTAAGGCCCGGTGG + Intronic
1183026356 22:35068383-35068405 CAGGCATGAGGAAGACCAGGAGG + Intronic
1184510808 22:44932116-44932138 CCTCCACTGGGAAGACCCGGAGG + Intronic
954526570 3:51277097-51277119 CACCCAAGGGGAAGACCCTGAGG + Intronic
961869025 3:129974965-129974987 TGCGCTCGGGGAGGACCCGGGGG - Intronic
967994230 3:195154619-195154641 CACCCTCAGGGAAGAACCGGGGG + Intronic
986859160 5:11905269-11905291 TACGCATGGGGAAGTCCCGATGG - Intergenic
1001333737 5:170781123-170781145 CAGGCAAGGGGAAGACCCACAGG + Intronic
1002183135 5:177441711-177441733 GAGGGACGGGGAAGACACGGAGG - Intronic
1005490222 6:26341276-26341298 CACGCATGGAGAAGAACCGCTGG - Intergenic
1006393296 6:33771526-33771548 GACACACGGGGAAGACTCGCTGG + Exonic
1018737431 6:166697902-166697924 CTGGCACGGGGAGGACTCGGCGG + Intronic
1018978388 6:168582818-168582840 CACGCACGGGGAAGACCCGGGGG + Intronic
1019743732 7:2688304-2688326 GGCGCGCGGGGAAGACTCGGGGG + Intronic
1033248744 7:139740562-139740584 CTGGCAGGGAGAAGACCCGGAGG + Intronic
1034977802 7:155458256-155458278 CACGCCCTCGGAAGACTCGGCGG + Exonic
1037787667 8:21912222-21912244 GACTCACGGGGAAGGCCAGGAGG + Exonic
1047499810 8:125431990-125432012 CGCGCAGGAGGAGGACCCGGCGG - Intronic
1049600615 8:143505733-143505755 CACACACGGAGAAGACACTGAGG + Intronic
1061177360 9:129005808-129005830 CAGGCAGGGGGAGGAGCCGGGGG - Intronic
1062325570 9:136010968-136010990 CACACAGGTGGAAGGCCCGGTGG + Exonic
1199899493 X:152159123-152159145 CAAGCACAAGGAAGACCAGGAGG - Intergenic