ID: 1018982219

View in Genome Browser
Species Human (GRCh38)
Location 6:168610254-168610276
Sequence CTGGTTTTCGTCTGAGGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018982219_1018982225 20 Left 1018982219 6:168610254-168610276 CCCACACCTCAGACGAAAACCAG 0: 1
1: 0
2: 0
3: 6
4: 93
Right 1018982225 6:168610297-168610319 ACGTGACGCAAACTGTGCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018982219 Original CRISPR CTGGTTTTCGTCTGAGGTGT GGG (reversed) Intronic
900340296 1:2185433-2185455 GTGGGTTGCGTCTGAGATGTGGG - Intronic
902494558 1:16860900-16860922 CTGGTTTGTGTCTTGGGTGTTGG + Intronic
905044452 1:34985045-34985067 CTGGCTTTCGACTGAGGCGCAGG - Intronic
911216082 1:95196639-95196661 CTGGTTTTGGTCTTATGTATAGG - Exonic
915661414 1:157408779-157408801 CAGGTTGTCTTCTGAGGTGCTGG + Intergenic
920118413 1:203637573-203637595 TAGGTTTTCATCTGAGCTGTGGG + Intronic
922863478 1:228839067-228839089 CTGACTTTCTTCTGGGGTGTGGG + Intergenic
1066478434 10:35771177-35771199 CTGGTTGTCAACTAAGGTGTTGG + Intergenic
1076756717 10:132576379-132576401 CGGGTTTTCCTTTCAGGTGTGGG + Intronic
1081568325 11:44274210-44274232 CTGGTTTGCTTCTGTTGTGTTGG + Intronic
1083031037 11:59592679-59592701 CTGGATTTCTTCTAAGGTATAGG + Intronic
1090700249 11:129288286-129288308 CTGGTTTTATGCTGAGGTCTTGG + Intergenic
1091194397 11:133719051-133719073 CTGGTTTCCATCTGGGGTGATGG + Intergenic
1096044612 12:48551809-48551831 CTGCCCTTCGTCTGAGATGTGGG + Intergenic
1102819943 12:115899448-115899470 CTGGTTCTCCTTTGAGGCGTGGG - Intergenic
1114076309 14:19163052-19163074 CTGGTGTTCATCTGAGGGCTTGG + Intergenic
1114085855 14:19236517-19236539 CTGGTGTTCATCTGAGGGCTTGG - Intergenic
1114863885 14:26563156-26563178 CTGGTTTTAGTCTTTTGTGTTGG - Intronic
1115602203 14:34966333-34966355 CTGGTTTTCTTCTGATATGTAGG + Intergenic
1116700945 14:48241131-48241153 GTGGTTTTCCTCAGAGTTGTCGG - Intergenic
1120252924 14:82081235-82081257 CTTGTTTTCTTGTCAGGTGTGGG + Intergenic
1202897410 14_GL000194v1_random:18229-18251 CTGGTGTTCATCTGAGGGCTTGG - Intergenic
1127321003 15:57846293-57846315 TTGGTTTTCCTCTGAGCTCTGGG + Intergenic
1131873329 15:96781841-96781863 CTGGTTTTCATCTGCAGTGATGG + Intergenic
1133607717 16:7404605-7404627 CAGGGTCTCTTCTGAGGTGTAGG - Intronic
1138548963 16:57736631-57736653 GTTGTTTTTGTCTGACGTGTGGG - Intronic
1140684805 16:77423142-77423164 GTAGTTAACGTCTGAGGTGTAGG - Intronic
1141161937 16:81635058-81635080 CTGCTCTTCCTCTGTGGTGTGGG - Intronic
1143319142 17:6056698-6056720 CTGGCTGTCTTCTGGGGTGTGGG - Intronic
1147758730 17:42784195-42784217 CAGGTTCTCTTCTGAGGTGGGGG - Intronic
1155390173 18:25327442-25327464 CTGATTTTCTTTTTAGGTGTGGG - Intronic
1161484568 19:4528215-4528237 CTGCTTTTCTGCTGAGGTGGGGG + Intronic
1161889743 19:7026203-7026225 CTGGTTTTTGTTTCACGTGTAGG + Intergenic
1161891709 19:7044543-7044565 CTGGTTTTTGTTTCACGTGTAGG - Intergenic
1162809361 19:13154920-13154942 CTGGTTTTCTGCTGTGGTGGGGG + Intergenic
1163983317 19:20922197-20922219 CCTGTTTTCTTCTGTGGTGTGGG - Intergenic
1164792273 19:30997353-30997375 CAGGTTTTCCTCTGATGTGTTGG + Intergenic
1167588764 19:50391161-50391183 CTGCTCATCGTCTGAGATGTGGG - Intronic
925403085 2:3589838-3589860 ATAGTTTTTGTATGAGGTGTGGG + Intergenic
926223475 2:10951465-10951487 CTGCTCTTCCTCTGAGATGTGGG + Intergenic
927489880 2:23514235-23514257 CTGTTTTTCATCTGAGGAGCTGG + Intronic
929547735 2:42866646-42866668 GTGGTAATCCTCTGAGGTGTGGG + Intergenic
933336568 2:80966910-80966932 CTGCTTTTCGTCTTATGTTTGGG - Intergenic
938490904 2:131760573-131760595 CTGGTGTTCATCTGAGGGCTTGG + Intronic
939747737 2:145998134-145998156 CTGGTTTTGGTTTCAGGTATTGG - Intergenic
940336127 2:152529360-152529382 TTCTTTTTCTTCTGAGGTGTGGG - Intronic
946488141 2:220120865-220120887 CTGGTTTTCCTCTTAGCTCTAGG + Intergenic
947504508 2:230696839-230696861 CTGGTTTTTCTATGAGGAGTAGG + Intergenic
1174767257 20:53265799-53265821 CTGGTTTTCTGCTGATGTGTGGG - Intronic
1176617095 21:9034218-9034240 CTGGTGTTCATCTGAGGGCTTGG - Intergenic
1180292115 22:10856676-10856698 CTGGTGTTCATCTGAGGGCTTGG + Intergenic
1180494919 22:15886098-15886120 CTGGTGTTCATCTGAGGGCTTGG + Intergenic
1184943042 22:47782734-47782756 GTGGATTTCCTTTGAGGTGTGGG + Intergenic
952036549 3:29209321-29209343 CTGGCTTTCTTCTGAGGCTTTGG - Intergenic
959010209 3:101066796-101066818 CTGTCTTTCCTCAGAGGTGTTGG + Intergenic
967867600 3:194203451-194203473 CTGGTTAGTGTCTGAGGTGGTGG + Intergenic
969087850 4:4669773-4669795 CTGGATTTGGTCAGAGGTGTTGG + Intergenic
973662211 4:53119762-53119784 CTGGGTTTCATCTGTGTTGTTGG - Intronic
974742683 4:66027248-66027270 CGGCTTTTGGTCTGAGATGTAGG + Intergenic
978669511 4:111229157-111229179 TTTGTTTTCTTCTGAGTTGTTGG - Intergenic
980036386 4:127887442-127887464 ACGGTTTCAGTCTGAGGTGTCGG - Exonic
985684790 5:1276269-1276291 TTGGTTTTCATGTGTGGTGTAGG - Intronic
985684878 5:1276636-1276658 TTGGTTTTCATGTGTGGTGTAGG - Intronic
986592432 5:9385444-9385466 CTGGGTTTCTTCTGAGCTATAGG + Intronic
990400819 5:55435817-55435839 GTGGTTTCCTTCTGAGGCGTCGG - Intronic
990940156 5:61194034-61194056 CTAGGTTTCATCTGAGATGTCGG + Intergenic
993678225 5:90843612-90843634 CTGGGTTTTGTCTGAGGCTTTGG - Intronic
995357889 5:111260564-111260586 CTAGCTTTCTTCTGAGCTGTAGG + Intronic
999301970 5:150496797-150496819 TTGGTTTCCGTCTGGGGTTTGGG - Intronic
1002193391 5:177490192-177490214 CTGGTTTGCATTTGGGGTGTGGG - Intronic
1005529169 6:26685398-26685420 CTTGTCTTCGTTTGAGGTCTGGG + Intergenic
1005531175 6:26708284-26708306 CTTGTTTTCTTTTGAGGTCTAGG + Intergenic
1005539621 6:26793352-26793374 CTTGTTTTCTTTTGAGGTCTAGG - Intergenic
1005541627 6:26816248-26816270 CTTGTCTTCGTTTGAGGTCTGGG - Intergenic
1006277062 6:33013576-33013598 CTGTTTTTCTTTTGAGGTGTCGG + Intergenic
1009012435 6:57858305-57858327 CTTGTCTTCGTTTGAGGTCTGGG - Intergenic
1018982219 6:168610254-168610276 CTGGTTTTCGTCTGAGGTGTGGG - Intronic
1021858776 7:24884700-24884722 CTTGTTTTCTTATTAGGTGTAGG - Intronic
1028446151 7:90926679-90926701 TTGGTGTCTGTCTGAGGTGTTGG - Intronic
1028874490 7:95805695-95805717 CTGGTTTTTGTATAAGATGTGGG - Intronic
1036652456 8:10654080-10654102 CTGGACCTCGTCTGAGGTCTGGG + Intronic
1038530653 8:28315957-28315979 CTGGATTTAGACTGAGGTGATGG - Intergenic
1043017246 8:74954627-74954649 ATGGTTGTCATCTGAAGTGTAGG + Intergenic
1053644999 9:40114944-40114966 CTGGTGTTCATCTGAGGGCTTGG + Intergenic
1053760721 9:41348584-41348606 CTGGTGTTCATCTGAGGGCTTGG - Intergenic
1054326019 9:63712842-63712864 CTGGTGTTCATCTGAGGGCTTGG + Intergenic
1054539576 9:66261025-66261047 CTGGTGTTCATCTGAGGGCTTGG - Intergenic
1054721746 9:68610708-68610730 GTGGTTTTCATCTGAGGAGAAGG + Intergenic
1055062405 9:72083635-72083657 CTGATTTTGTTCAGAGGTGTTGG - Intergenic
1057480886 9:95444843-95444865 CTTCTTTTGCTCTGAGGTGTGGG - Exonic
1057568919 9:96188994-96189016 CTGGTTTTGGTCTGTGGCCTTGG + Intergenic
1060509775 9:124223441-124223463 GTGGTTTAGGTCTGAGGGGTGGG + Intergenic
1185498341 X:576673-576695 CTGGTTTTCATTTGAGTTGTTGG - Intergenic
1189693153 X:43637584-43637606 GGAGTTTTCGTCTGATGTGTAGG + Intergenic
1190376273 X:49791487-49791509 AAGGTTTAAGTCTGAGGTGTTGG + Intergenic
1195105996 X:101601601-101601623 CTTGTTTTGGTGTGAGGTTTAGG + Intergenic
1195106887 X:101612166-101612188 CTTGTTTTGGTGTGAGGTTTAGG - Intergenic
1196146674 X:112326222-112326244 CTGCTTTCCATCTGAGGTGCCGG + Intergenic
1196471940 X:116038536-116038558 CTGCTTTTTGACTGAGGTTTAGG - Intergenic
1201150487 Y:11093051-11093073 CTGGTGTTCATCTGAGGGCTTGG - Intergenic