ID: 1018983332

View in Genome Browser
Species Human (GRCh38)
Location 6:168616767-168616789
Sequence GTCTTATGATGCCTCTGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 117}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018983332_1018983341 6 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983341 6:168616796-168616818 AGCAGGGACAAGGGGTGCCGAGG 0: 1
1: 0
2: 0
3: 49
4: 309
1018983332_1018983343 20 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983343 6:168616810-168616832 GTGCCGAGGAGTCAAGCGGTTGG 0: 1
1: 0
2: 1
3: 0
4: 40
1018983332_1018983337 -10 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983337 6:168616780-168616802 ATCATAAGACAGGAAGAGCAGGG 0: 1
1: 0
2: 1
3: 27
4: 360
1018983332_1018983340 -2 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983340 6:168616788-168616810 ACAGGAAGAGCAGGGACAAGGGG 0: 1
1: 0
2: 8
3: 62
4: 780
1018983332_1018983338 -4 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983338 6:168616786-168616808 AGACAGGAAGAGCAGGGACAAGG 0: 1
1: 0
2: 11
3: 79
4: 972
1018983332_1018983339 -3 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983339 6:168616787-168616809 GACAGGAAGAGCAGGGACAAGGG 0: 1
1: 0
2: 9
3: 158
4: 690
1018983332_1018983344 21 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983344 6:168616811-168616833 TGCCGAGGAGTCAAGCGGTTGGG No data
1018983332_1018983346 27 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983346 6:168616817-168616839 GGAGTCAAGCGGTTGGGAAAAGG No data
1018983332_1018983347 30 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983347 6:168616820-168616842 GTCAAGCGGTTGGGAAAAGGTGG No data
1018983332_1018983342 16 Left 1018983332 6:168616767-168616789 CCATCCCAGAGGCATCATAAGAC 0: 1
1: 0
2: 0
3: 7
4: 117
Right 1018983342 6:168616806-168616828 AGGGGTGCCGAGGAGTCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018983332 Original CRISPR GTCTTATGATGCCTCTGGGA TGG (reversed) Intronic