ID: 1018983421

View in Genome Browser
Species Human (GRCh38)
Location 6:168617412-168617434
Sequence CCCAAGGACGGGTCTCCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018983414_1018983421 8 Left 1018983414 6:168617381-168617403 CCGACGTGGCTGAGCAGGAGCTT No data
Right 1018983421 6:168617412-168617434 CCCAAGGACGGGTCTCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018983421 Original CRISPR CCCAAGGACGGGTCTCCCAG GGG Intronic