ID: 1018984044

View in Genome Browser
Species Human (GRCh38)
Location 6:168622348-168622370
Sequence GCAGCCTCCCAAGCCAGAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 6, 2: 44, 3: 102, 4: 385}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018984044 Original CRISPR GCAGCCTCCCAAGCCAGAAC AGG (reversed) Intronic
900639813 1:3683236-3683258 CCAGGCTCCCAAGACAGGACAGG - Intronic
900733252 1:4276975-4276997 GCAGCCTCCCAAGCCGGTGTAGG - Intergenic
900804397 1:4757708-4757730 GCAGTGTCCCCATCCAGAACAGG - Intronic
901500422 1:9649549-9649571 GCAGCCTCTGGAGCCAGCACGGG + Intergenic
902162527 1:14542910-14542932 TCAGCCTGCCCAGCCAGAAGTGG + Intergenic
903811943 1:26039453-26039475 GTAGCCTCCCAGCCCAGACCTGG + Intronic
903820858 1:26101457-26101479 GCATCCTCACAAGGCAGAAGTGG - Intergenic
904475993 1:30764927-30764949 GCATCCTCACAAGCAAGCACAGG - Intergenic
905561687 1:38932203-38932225 GCAACCTCCTGAGCCAGACCAGG - Intronic
905959882 1:42035268-42035290 GCAGCCTCCCGGCCCAGAGCCGG + Intronic
906034118 1:42740300-42740322 GCAGCCGCCTAAGCCAGAGCAGG + Intergenic
906503845 1:46362489-46362511 GCAGCCTCCTAAGCCACATTTGG - Intronic
907471325 1:54675578-54675600 GCAGCGTCCCGAGCCAGAATAGG - Intronic
907484514 1:54767914-54767936 GGAGCTTCCCAAGCCAAAAATGG + Intergenic
908085989 1:60634553-60634575 GCTGCCTCCAAGGCTAGAACTGG - Intergenic
908265256 1:62372384-62372406 GCAGCCTCCCAAACCAGAGCAGG - Intergenic
908803808 1:67908844-67908866 GCAGCCTCCCAAACCATCGCAGG - Intergenic
909691569 1:78413089-78413111 ACACCCTCCCAAGACTGAACTGG + Intronic
909802804 1:79833882-79833904 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
910990721 1:93053251-93053273 GGAGCCTCCTGAGCCAGAATAGG + Intergenic
912510555 1:110187249-110187271 GCAGCCTTCCGAGCCAGAGTAGG + Intronic
913474764 1:119226646-119226668 AAAGCTTCCCAAGCCAGCACTGG - Intergenic
913987231 1:143576000-143576022 GCAGGCTGCCCAGCCAGAAGCGG + Intergenic
914875412 1:151509945-151509967 GCAGCCTCCTGAACCAGAATAGG - Intergenic
915812449 1:158928818-158928840 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
915922992 1:159991819-159991841 GCAGCTTCCCAAACTAGAATAGG - Intergenic
916035035 1:160914193-160914215 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
916734438 1:167594956-167594978 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
916735284 1:167601973-167601995 GCAGCCTCTCAAACCAGAGTAGG - Intergenic
917080050 1:171248517-171248539 GGGGACTCCCAAGCCAGCACTGG + Exonic
917650992 1:177077248-177077270 AGAGCATCCCAAGCCAGTACTGG - Intronic
917832864 1:178912518-178912540 GAAGCCTAACAAGCCAGAAGAGG - Intronic
918351093 1:183656651-183656673 GCAGCTCCCCAAACCAGAATAGG - Intronic
919462102 1:197890137-197890159 GCAGCCCCCAGAACCAGAACAGG - Intergenic
919703520 1:200655054-200655076 GCAACCTCCTGAGCCAGAAAAGG + Intronic
920566554 1:206978577-206978599 GCAACCTCCTGAGCCAGAATAGG - Intergenic
920986346 1:210893658-210893680 GCAGCCTCACAAGCCAGAGTAGG + Intronic
924469213 1:244325102-244325124 GCAGCCTCCCAGGCCAGAGCAGG + Intergenic
924817467 1:247455329-247455351 GCAGCCTCCCATCCCACAACCGG + Intergenic
1063020534 10:2122625-2122647 GCAGCCTTCCCAGCCAGACTGGG - Intergenic
1063187150 10:3661881-3661903 GCAGCCTCCCAAGACAGAGGAGG + Intergenic
1063347051 10:5321482-5321504 GCAGCCTCCAAAGCCAGAGTAGG - Intergenic
1063408925 10:5821597-5821619 GCAGCCTCCTGAACCAGAATAGG - Intronic
1063488319 10:6440455-6440477 GCAGCCTCCTACCCCTGAACTGG - Intronic
1064045560 10:12011481-12011503 TCAGCCTCCCAAGCAATAACTGG - Intronic
1064324226 10:14333618-14333640 CTAGCCTCCCAGGACAGAACAGG - Intronic
1064941713 10:20742573-20742595 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
1065495826 10:26326976-26326998 GCAGCCTCCTGAGCCAGAGAAGG + Intergenic
1065966916 10:30778190-30778212 GCAGAGTCCCAAGGCAGCACAGG - Intergenic
1067274178 10:44819722-44819744 GCAGATGGCCAAGCCAGAACCGG - Intergenic
1067914998 10:50387757-50387779 GCAGCCTCCCAAGCCACGGTAGG + Intronic
1067973039 10:50992787-50992809 GCAGACTCCAAAGCCATTACTGG + Intronic
1068358275 10:55940911-55940933 GCAGCCTCCCAAGCCAGAGCTGG + Intergenic
1068693926 10:59945837-59945859 GCAGCCTACAGAACCAGAACAGG + Intergenic
1069706595 10:70462647-70462669 GGTGCCTCCCTTGCCAGAACAGG + Intergenic
1070081576 10:73193942-73193964 GCAGGGTCCCAAGGCAGTACAGG + Intronic
1070794266 10:79207798-79207820 GCAGGCTCCAAAGCCAGAGCTGG + Intronic
1071011542 10:80945991-80946013 GCAGCCTCTCAAGCCAGAGTAGG - Intergenic
1071334278 10:84588753-84588775 GGAGCCATCCAAGCCAGACCCGG - Intergenic
1071908697 10:90205090-90205112 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1071939379 10:90572053-90572075 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1072469334 10:95697669-95697691 GCAGCATCCCAAGGCAGCACAGG - Intergenic
1072601594 10:96936030-96936052 GCAGCCTCCCGAGCCACAGTAGG + Intronic
1073101314 10:101008208-101008230 CCAACCTCCCAAGCCAGGATAGG - Intronic
1075076902 10:119357923-119357945 GCAGCCTCCCAAGCCAGGGGTGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1077720345 11:4621891-4621913 GCAGCCCTCAAAACCAGAACAGG - Intergenic
1079211363 11:18463338-18463360 GCAGAGTCCCAAGGCAGCACAGG - Intronic
1080164585 11:29221660-29221682 ACAGCCTCCCAAGACTGAACTGG - Intergenic
1082666739 11:55983800-55983822 GCAGTTTCCAAAACCAGAACAGG + Intergenic
1083389148 11:62335328-62335350 GCAGCCCCCCAATCCAGTTCTGG + Intergenic
1083620380 11:64046405-64046427 GCAGCCTCGCACCCCAGCACAGG - Intronic
1083919154 11:65771767-65771789 GCAGCCTCTCATGCCAGAGTGGG + Intergenic
1084532054 11:69733113-69733135 GGGGCATCCGAAGCCAGAACAGG + Intergenic
1086042254 11:82493802-82493824 GCAGCCTCCCAAGCCAGAATAGG - Intergenic
1087266854 11:96070421-96070443 GGAGCTTCCCAAGCCAGGGCTGG + Intronic
1087817095 11:102671256-102671278 GCAACCTGCCAAGACTGAACCGG - Intergenic
1088740415 11:112762458-112762480 GCAGCCTCCCAGGTAAGACCAGG + Intergenic
1088999293 11:115037212-115037234 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1089141869 11:116291782-116291804 TCAGCCTCCCAAACCAGAGCAGG + Intergenic
1089596069 11:119581135-119581157 GCAGGCTCCCAAGCCCGAGTAGG + Intergenic
1089941186 11:122419245-122419267 GCAGCCTCCTGAGGCAGAATAGG + Intergenic
1090293013 11:125562756-125562778 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1090846741 11:130535893-130535915 GCAGCCCCCAGAACCAGAACAGG - Intergenic
1090889025 11:130906426-130906448 CCAACCTGCCAACCCAGAACTGG + Intronic
1091391335 12:128156-128178 CCTGCCTCCCAAGCCTGCACTGG + Intronic
1091703560 12:2679362-2679384 GCAGCCTCCACAGCCAGGTCAGG - Intronic
1091896435 12:4108991-4109013 GCTGCCTCCTTAGACAGAACGGG + Intergenic
1092019787 12:5191829-5191851 GAAGCCACCAAAGCCAGAAGAGG + Intergenic
1094437735 12:30440034-30440056 GTATCCTCACAAGCCAGAAAAGG + Intergenic
1096435130 12:51583387-51583409 CCAGCCTCCCACCCCACAACAGG - Intergenic
1096833206 12:54330610-54330632 TCTGCCTCCCAAGGCAGACCTGG - Intronic
1097602644 12:61713359-61713381 GCAGTCTCCCAAGCAAGAGTAGG - Intronic
1097903380 12:64895754-64895776 GCAGCCTTCTGAGCCAGAATAGG - Intergenic
1098172200 12:67758339-67758361 GCAGCATCCCCAGACAGAACAGG - Intergenic
1098293741 12:68983259-68983281 GCAGCCTCCTGAGCCAGAATAGG - Intergenic
1098295320 12:68998294-68998316 GCAGCCCCCTAAGCCAGAATAGG - Intergenic
1098712122 12:73775933-73775955 GCAGCTTCCTGAGCCAGAGCAGG - Intergenic
1099291450 12:80781343-80781365 GCAGCCTCCCAAGCAAGAGTAGG - Intergenic
1099713901 12:86265240-86265262 GCAGCCTGCCAGGCCAAAACAGG + Intronic
1099802262 12:87472136-87472158 GCAGCCCTGCAAGCCAGAATAGG - Intergenic
1099936917 12:89137334-89137356 GCAGCCTCCCGAGCCAGAGTGGG - Intergenic
1100087290 12:90927315-90927337 GTAGCCTCCCAACCAAAAACAGG + Intronic
1101101860 12:101401964-101401986 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
1101162364 12:101992263-101992285 GCAGCCTTCCCAGCCAGAGTTGG + Intronic
1102250023 12:111380545-111380567 GCAGGCTCCCAGGCCAGCCCTGG + Intergenic
1102469369 12:113150850-113150872 GCAGCCACCCTAGCCACACCAGG + Intronic
1104747443 12:131219350-131219372 GCAGCCTCGCAAGACAGAGGAGG - Intergenic
1104943429 12:132405249-132405271 GCAGCTCCCCAGGCCAGACCAGG - Intergenic
1105019522 12:132806616-132806638 TCACCCTCCCACGCCAGAAGCGG + Intronic
1105293674 13:19070818-19070840 GCAGCCTCCCCATCCACAGCTGG + Intergenic
1105320165 13:19312034-19312056 ACAGCCTCCCAAAGCTGAACCGG - Intergenic
1105636818 13:22223665-22223687 GCAGCCTCTTGAACCAGAACAGG - Intergenic
1106083240 13:26517869-26517891 GCCGGTTCCCAAGACAGAACTGG + Intergenic
1106610796 13:31278660-31278682 GTAGCCTGCCAAGCCACCACTGG + Intronic
1106872272 13:34034640-34034662 GCAGCCTCCTGAGCCACAGCAGG - Intergenic
1107776945 13:43854403-43854425 ACACCCTCCCAAGACTGAACCGG + Intronic
1108474370 13:50799050-50799072 GAAACCTCAAAAGCCAGAACAGG + Intronic
1108514903 13:51191858-51191880 GCGGCCTCCCAAGCCAGAGTAGG + Intergenic
1109145525 13:58774092-58774114 GCAGGCTGCCAAGCCAGCAGTGG + Intergenic
1110066896 13:71119543-71119565 GCAGCCTCCCAAACCAGAGTAGG + Intergenic
1110982319 13:81916648-81916670 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1111044805 13:82800592-82800614 GCATCCTCCCGAGCCAGATGAGG + Intergenic
1111935463 13:94552507-94552529 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1111978749 13:94995266-94995288 TCAGCCTCCCAAGTTAGAGCTGG - Intergenic
1114757875 14:25280748-25280770 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1115578299 14:34732849-34732871 GCAGCCTCCTGAACCAGAATAGG + Intergenic
1115767357 14:36637111-36637133 CCAGCCTCCCACCCCACAACAGG + Intergenic
1116000164 14:39234520-39234542 GCAGCCTTCTGAGCCAGAATAGG - Intronic
1117204857 14:53431375-53431397 GCAGCCTCCCGAGCCAGAGCAGG + Intergenic
1118426231 14:65666459-65666481 ACAACCTCCCAAGACTGAACCGG + Intronic
1118642781 14:67807776-67807798 GCAGTCTCCCCAGCCAGCACAGG - Exonic
1118973213 14:70654739-70654761 GCAGCCTCCCAAGCCCGAATAGG + Intronic
1119313571 14:73672109-73672131 GTAACCTCCCAAGACAAAACAGG + Intronic
1119427304 14:74544025-74544047 GCACCCTCCCAACCCAGCAGGGG - Intronic
1120324397 14:83006973-83006995 GCAGAGTCCCAAGGCAGCACAGG + Intergenic
1120357727 14:83455890-83455912 GCAGCTTCCGAAGCCAGAGGAGG - Intergenic
1120649407 14:87113537-87113559 GCAGCCTCCCGAGCCAGAGTAGG - Intergenic
1120649967 14:87120154-87120176 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1122743464 14:103885032-103885054 GGAGCCATCCAAGCCAGAAGGGG - Intergenic
1202835934 14_GL000009v2_random:77287-77309 GCACCGTCCCATCCCAGAACTGG - Intergenic
1125049219 15:35278207-35278229 GTAGCCTCCCAAGGCTGAGCAGG - Intronic
1126084230 15:44996166-44996188 CCAGCCTCCCAAGCCCTGACAGG - Intergenic
1126113970 15:45192293-45192315 GCAGCCTCCTGAGCCAGAGTAGG + Intronic
1126319022 15:47401952-47401974 GTTGCCTCCCAAGCCAGAATTGG + Intronic
1128408687 15:67370540-67370562 GCAGCCTCTCCTGCCAGCACTGG + Intronic
1128477302 15:68008209-68008231 GCACCCTCACATGCCAGAGCAGG - Intergenic
1128533535 15:68471699-68471721 CCAGCCTCCTAAGCCAGAGTAGG - Intergenic
1129178170 15:73854992-73855014 CCAGCCTCTAAAGCCAGGACTGG - Intergenic
1129590017 15:76906532-76906554 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1131086479 15:89579784-89579806 GCAGAGTCCCAAGGCAGCACAGG - Intronic
1131154752 15:90067848-90067870 GGAGCCTGTCAAGCCGGAACAGG + Exonic
1131332950 15:91519041-91519063 ATAGCCTCCCAAGCCAGAGTAGG + Intergenic
1133910956 16:10066162-10066184 GCAGCCTCCCACTCCAACACCGG - Intronic
1134972735 16:18544674-18544696 GCAGCCCCCTGAGCCAGAATAGG - Intronic
1135081362 16:19438877-19438899 ACAGCCTCCCCAGCCAGAATAGG + Intronic
1135096167 16:19566573-19566595 GCAGCCTCCTGAGCCAGAGTAGG + Intronic
1135193378 16:20373842-20373864 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
1136136963 16:28262101-28262123 CCACCCTCCCCAGCCAGCACTGG - Intergenic
1136677830 16:31929411-31929433 ACAACCTCCCAAGACTGAACTGG + Intergenic
1137541667 16:49366960-49366982 GCGGCCTCCCAAGCCAGAGTAGG - Intergenic
1137660071 16:50197625-50197647 GCAGCCTCCCGAGCCAGAGTAGG + Intronic
1138353440 16:56359103-56359125 GCAGCCCCCAGAGCCAGAAGAGG - Intergenic
1139010895 16:62632843-62632865 GCAGCCTCCAAAGCCAGCGTAGG + Intergenic
1140024764 16:71276181-71276203 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1142524435 17:529545-529567 GCAGCCTCCTCAGCCAGAGCAGG + Intronic
1143650070 17:8257926-8257948 CCAGCCTCACCAGCCAGCACTGG - Exonic
1144008294 17:11121437-11121459 GCAGCCTCCCGAGCCAGAATGGG + Intergenic
1144542795 17:16160895-16160917 GCAGCCTCCTGAGCCAGAATAGG - Intronic
1144647673 17:16986691-16986713 GCAGCAGCCCAAGCCACACCTGG - Intergenic
1144958454 17:19031518-19031540 GCAGCCTTCCAGGCCAGGAGGGG + Intronic
1144976705 17:19143006-19143028 GCAGCCTTCCAGGCCAGGAGGGG - Intronic
1146692288 17:34884636-34884658 GCAGCCTCCCAAGAAAGGTCCGG + Intergenic
1147624384 17:41890355-41890377 TCAGCTTCCCAAGCCAGAGGAGG - Intronic
1148505084 17:48120924-48120946 GCAGCCTCCTGAGTCAGAACAGG + Intronic
1148830509 17:50427691-50427713 GCAGCCTCCTGAGCCAGAGTAGG - Intronic
1148982950 17:51595063-51595085 GCAGCCTCCTAAGCCAGAGTAGG + Intergenic
1149286071 17:55165813-55165835 GCATCCTCACAAGGCAGAAGGGG - Intergenic
1149342854 17:55704444-55704466 TCAGCTTCCCAAACCAGAATAGG + Intergenic
1149982276 17:61320556-61320578 TCAGCCTCCCAAGCAGGTACAGG - Intronic
1150920524 17:69477520-69477542 GCAGCCTTCCAATCCAGCAGAGG - Intronic
1151993466 17:77593578-77593600 GCAGGCTCCCAAGACTGAATGGG - Intergenic
1151996122 17:77610258-77610280 GCAGCCTCCCGAGCCAGAGTGGG + Intergenic
1152774724 17:82193922-82193944 GCAGCCTCGCAGGCCAGGACTGG - Intronic
1153118060 18:1685143-1685165 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
1153386356 18:4501904-4501926 TCAGCCTCCCAAGCCATTTCAGG - Intergenic
1153750236 18:8222040-8222062 GCAGCCTCCCAAGCCAAAGTAGG - Intronic
1153812321 18:8762876-8762898 GCTGCTTCCCAAGCCTGAGCCGG - Intronic
1155328152 18:24686988-24687010 GCAGCCCTCCGAACCAGAACAGG + Intergenic
1155606788 18:27615545-27615567 GTAGCCTCCGAAGCCAGAGTAGG + Intergenic
1155720694 18:29008151-29008173 GCAGCCACCCAAGCCAGAGTAGG - Intergenic
1155991151 18:32280790-32280812 TCAGCCTCCCATTCCAGAAGTGG - Intronic
1156659408 18:39328983-39329005 GCAGCCTCCTGAGCCAGAGTTGG + Intergenic
1157112225 18:44832311-44832333 GCAGCATCCCAGGCCAGGCCCGG + Intronic
1157149007 18:45195934-45195956 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1157773563 18:50372847-50372869 GCAGCCTCCCCAGCCGGAGTAGG + Intergenic
1158342866 18:56485546-56485568 CCAGCCTCCCACCCCACAACAGG + Intergenic
1158564490 18:58543165-58543187 GCAGAGTCCCAAGGCAGAGCAGG - Intronic
1158593657 18:58798195-58798217 GCAGCCTCCAGAACCAGAATAGG - Intergenic
1158695010 18:59696567-59696589 GCCGCCTCCCCAGCCAGCCCCGG + Intronic
1160944876 19:1637033-1637055 GCAACCTCCTCCGCCAGAACCGG + Intronic
1161020918 19:2011152-2011174 GGAGCATCACAAGCCAGGACAGG - Intronic
1162085137 19:8244178-8244200 GCAGCCTCTAAAGCCAGAAAAGG + Intronic
1164004853 19:21139152-21139174 GCAGCCTGTGAATCCAGAACAGG - Intergenic
1164448223 19:28335762-28335784 GCATCCTCCCAGGCTAGAAGAGG - Intergenic
1164501292 19:28822513-28822535 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
1164628869 19:29747867-29747889 GCCACCCTCCAAGCCAGAACAGG + Intergenic
1165743626 19:38217695-38217717 GCAGCCTCCCAACCCGGGTCTGG + Intronic
1202636703 1_KI270706v1_random:50075-50097 GCACCGTCCCATCCCAGAACTGG + Intergenic
925938520 2:8791372-8791394 GTAGCCTTCCAAGTCAGAATAGG - Intronic
927548760 2:23978308-23978330 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
927783586 2:25957426-25957448 GCACCCCCCCAAACCAGAATAGG - Intronic
928107097 2:28477592-28477614 GCAGCTTCCCCAGCCTGAATGGG - Intronic
930159086 2:48135036-48135058 GCAGCTTCCCAAAGCAGAAGAGG - Intergenic
931187974 2:59972171-59972193 GCAGCCTGGCAGGCAAGAACAGG + Intergenic
931393839 2:61868268-61868290 GCAGCCTCCCAAGCCAAAGTAGG + Exonic
932668485 2:73717217-73717239 GCGGCCTCCTGAGCCAGAATAGG - Intergenic
932908775 2:75783808-75783830 GCAGCTTCCCCAGCCAGCAATGG + Intergenic
932956164 2:76353197-76353219 GCAGCCTCCCAAGACAGACTAGG - Intergenic
933388407 2:81640149-81640171 GCAGCCTCCCACTCCCCAACAGG - Intergenic
933599120 2:84312032-84312054 GCAGCCCCCAGAACCAGAACAGG - Intergenic
933730631 2:85453632-85453654 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
934028783 2:88022754-88022776 GCAGCCTTCCCAGCCAGAGTAGG - Intergenic
934051052 2:88211294-88211316 GCCGCCTCCCAAACCAGAATAGG - Intergenic
935283364 2:101539591-101539613 GCAGACTCCCAAGCCAGAATAGG + Intergenic
936232470 2:110715128-110715150 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
937539426 2:122930149-122930171 GCAGCCTCTTAAGCCAGATTAGG + Intergenic
937628145 2:124067362-124067384 GCAGCTTCCAGAGCCAGAAGGGG - Intronic
937744087 2:125390072-125390094 GCTGCCTCCCACCCCACAACAGG + Intergenic
937770760 2:125718327-125718349 GCAATCTCCCAAGCCAGAGCAGG - Intergenic
938412478 2:131076283-131076305 CCAGCCTACCATGCCAGAAGAGG - Intronic
938755188 2:134372903-134372925 CCAGCTTCCCAAGCCAGCCCTGG - Intronic
939164246 2:138622926-138622948 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
939497141 2:142937559-142937581 GCAGCCTCTCAAGCCAGAGTAGG + Intronic
940499444 2:154475994-154476016 GCAGCCTCCTGAGCCAAAACAGG + Intergenic
940599071 2:155834794-155834816 GCAGAGTCCCAAGGCAGCACAGG + Intergenic
940716380 2:157229737-157229759 GCTGCCTCCCAAGCCAGAGTAGG + Intergenic
943584127 2:189717930-189717952 CCTGCCTCCCACCCCAGAACAGG - Intronic
944034685 2:195280227-195280249 GCAGCCTTCCCAGCCAGAGTAGG + Intergenic
944995579 2:205289843-205289865 GCAGAGTCCCAAGGCAGCACAGG - Intronic
945115862 2:206407355-206407377 CCAGCCTCCCACCCCAGGACAGG + Intergenic
945318721 2:208397148-208397170 CCAGCCTCCCACCCCACAACAGG - Intronic
945788815 2:214277963-214277985 GCAGCCAGGCAAGCTAGAACTGG - Intronic
945971367 2:216234639-216234661 GCAGCCTGCTCAGCCAGGACTGG - Intergenic
946054114 2:216886018-216886040 GCAGGCTGCCAAGCCAGCAGTGG + Intergenic
946159620 2:217828210-217828232 GCAGCTTCCAGAGACAGAACAGG - Intronic
946229068 2:218280451-218280473 GCAGCCAGCCAGGGCAGAACAGG + Intronic
946514986 2:220402187-220402209 GCAGCCTCCTAAGGCAGCTCAGG - Intergenic
947131728 2:226933680-226933702 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
947197466 2:227583284-227583306 GCAGTGTCCCAAGGCTGAACAGG - Intergenic
948538726 2:238669227-238669249 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
948784513 2:240345342-240345364 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
948978170 2:241476931-241476953 ACAGCATCCCCACCCAGAACAGG - Intronic
1169023746 20:2349859-2349881 GCACCCTCCCCAGCCAGGGCAGG + Intergenic
1169438596 20:5615097-5615119 GCAGCCTCCTTAGCCAGAGTAGG - Intergenic
1170148420 20:13202644-13202666 GTAGCCTCCCAAACCAGAATAGG + Intergenic
1170161267 20:13313559-13313581 GCAGTCTCCCGAGCCCGAATAGG - Intergenic
1170573187 20:17643910-17643932 GCAGCCTCGGAAGCAAGAAAGGG + Intronic
1172362538 20:34323852-34323874 GCAGCCTCCCAAGCCAGTGTAGG - Intergenic
1172620469 20:36315501-36315523 GCAGCCTGCCTAGGCAGGACTGG + Intronic
1172961818 20:38805589-38805611 GCTGCCTCCCAAGCCGGATGGGG + Intergenic
1173024059 20:39291468-39291490 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1173864012 20:46302842-46302864 ACAGCCTCCCGAGCCAGGAATGG + Intronic
1173915339 20:46703765-46703787 GCAGCCCCCCGAACCAGAATAGG - Intergenic
1174280567 20:49435910-49435932 GCAGCCTCCCAGGTCAGGCCAGG - Intronic
1174903932 20:54530252-54530274 GCAGACTCTCAAGCCAGAATAGG - Intronic
1175186891 20:57184811-57184833 GGAGCCTCTGAAGCCAGAAGAGG + Intronic
1175994356 20:62805435-62805457 GAAGCCTCCCAGGCCAGACCCGG - Intronic
1176077074 20:63253599-63253621 GCAGCTTCCCCAGCCTGGACAGG + Intronic
1176670596 21:9731598-9731620 GCAGCCTCCCAAATCAGAGAAGG - Intergenic
1177297239 21:19191959-19191981 GCAGCCTTCTGAGCCAGGACAGG + Intergenic
1178246048 21:30953647-30953669 GCAGCCTCCGAAGCCAGAGTAGG + Intergenic
1179462414 21:41546262-41546284 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1180364166 22:11924238-11924260 GCACCGTCCCATCCCAGAACTGG - Intergenic
1180978027 22:19861375-19861397 GCAGCCTCCCAAACCAGAATAGG + Intergenic
1181454788 22:23052822-23052844 GCAGCCTCCTGAGCCAGAATAGG + Intergenic
1181854722 22:25773790-25773812 GCAGCCTCCTGAGCCAGAGTAGG + Intronic
1182100592 22:27654974-27654996 GCAGCCTCGCCACCCAGAGCTGG + Intergenic
1182246327 22:28960707-28960729 GCAGCCTCCCCACTCGGAACTGG - Intronic
1183099618 22:35575757-35575779 GAAGCCTCCAATGCCAGAAATGG + Intergenic
1183103428 22:35598135-35598157 GCAGCCTCAGATGCAAGAACTGG + Intergenic
1183107374 22:35624221-35624243 GCAGCCTCCCGAGCCAGAGTAGG + Intronic
1184274897 22:43404615-43404637 CCAGCCTCCCCAACCACAACAGG - Intergenic
1184777992 22:46632854-46632876 GCACCCTCCCCAGCAAGCACAGG - Intronic
1185397358 22:50599984-50600006 GCTCCATCCCAAGCCAGAGCGGG + Intronic
949410746 3:3761460-3761482 GCAGCCTCCGGAGCCAGAGTAGG + Intronic
951527495 3:23667926-23667948 GCATCCTCACATGGCAGAACGGG - Intergenic
952280414 3:31917577-31917599 GCAGCCTCCAGAACCAGAATAGG - Intronic
952292849 3:32035163-32035185 GCAGGCTCCCAAACCAGAGTAGG - Intronic
952721336 3:36536182-36536204 ACACCCTCCCAAGACTGAACTGG - Intronic
952757055 3:36878882-36878904 GCAGCCTCCCTATCCAGATGAGG - Intronic
953356177 3:42258045-42258067 GCAACCTCCCAACCCAGAGGAGG - Exonic
953787550 3:45922342-45922364 GCACCGTCCCAAGCCCGAGCAGG - Intronic
954136299 3:48583670-48583692 GCAGCCTCCCACCCCAGAACTGG + Intronic
954566383 3:51603644-51603666 GCAGCCTTCCAAGCCACAGTAGG - Intronic
955643079 3:61107725-61107747 GCAGCCTTCTGAGCCAGAGCAGG + Intronic
956564037 3:70615395-70615417 GCAGCATCCCAAGGCTGCACAGG + Intergenic
957912518 3:86639114-86639136 ACACCCTCCCAAGACTGAACTGG - Intergenic
958565945 3:95810463-95810485 GCAGCCTCCCCAACCATAATAGG + Intergenic
958572765 3:95910331-95910353 GCAGCCCCCAAAACCAGAACAGG + Intergenic
958893471 3:99805310-99805332 GCAGTGTCCCAAGCCTGCACAGG + Intergenic
960740014 3:120822901-120822923 GCAGCCTCCCAAGCCAGAATAGG + Intergenic
961438219 3:126933986-126934008 GCAGAATCCCAACACAGAACGGG - Intronic
961826197 3:129600410-129600432 GCAGCCCCCTAAGCCAGAGTAGG + Intronic
963282292 3:143396436-143396458 CCAGCCCCCCAACCCACAACAGG - Intronic
964638683 3:158885552-158885574 GCAGCATCCCAAGGATGAACAGG - Intergenic
965018127 3:163187148-163187170 GCAGTCTTCCAAGCCAGAGTAGG - Intergenic
965095971 3:164226350-164226372 GCAGCCTCCTGAGCCAGAATAGG + Intergenic
965306213 3:167067008-167067030 GCATCCTACCAAGCCAGAAGGGG - Intergenic
966080889 3:175998887-175998909 ACACCCTCCCAAGACTGAACAGG + Intergenic
968119708 3:196117170-196117192 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
968167416 3:196478511-196478533 GCAGCCTCTCGAGCCAGAGTAGG - Intronic
968423456 4:504711-504733 ACAGCCACCCCAGCCAGCACTGG - Intronic
969096927 4:4740200-4740222 GCAGAGTCCCAAGGCAGTACAGG - Intergenic
969166200 4:5317700-5317722 GAAGCCTCCCAAACAAGAATAGG - Intronic
970204360 4:13641227-13641249 GCAGCCTTCCCAGCCAGAGTAGG + Intergenic
970695060 4:18667490-18667512 GCAGCCTCCTGAGCCAGAATAGG + Intergenic
970706905 4:18815686-18815708 GCAGCATCCCAAGGCAGCACAGG - Intergenic
971564084 4:28116788-28116810 GCAGGCTGCCAAGCCAGCAGTGG - Intergenic
972279311 4:37587082-37587104 GCAGCCCCCCAAGCTGGAAGAGG - Intronic
973394097 4:49578989-49579011 GCACCGTCCCATCCCAGAACTGG - Intergenic
973561638 4:52142983-52143005 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
974814335 4:66985896-66985918 ACACCCTCCCAAGACTGAACCGG - Intergenic
977838092 4:101669307-101669329 GCAGCCTCCTGAGCCAGAGTAGG - Intronic
978339686 4:107709082-107709104 GCAGCCTCCTGAGCCAGAGTAGG - Intronic
979207810 4:118061858-118061880 GCAGCCTCCCGAGCCAGAGTAGG + Intronic
979735164 4:124073580-124073602 GCAGCCTCGAAGGCCAAAACTGG + Intergenic
980252158 4:130331433-130331455 GCAGCCTCCTGAGCCAGAATGGG + Intergenic
980486903 4:133469816-133469838 GCAGCTTCCCGAGCCAGAGAAGG - Intergenic
980539989 4:134180807-134180829 ACAGCCTCCCAAGTTTGAACCGG + Intergenic
981045949 4:140265465-140265487 GCAGCCTCCTGAGCCACAATAGG + Intronic
981166060 4:141559015-141559037 GCAACCTCCCAAGATTGAACTGG + Intergenic
982454979 4:155598812-155598834 TCTGCCTCCCAAGGCAGAATTGG + Intergenic
982644611 4:158007878-158007900 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
982789103 4:159570035-159570057 ACACCCTCCCAAGACTGAACAGG - Intergenic
982911089 4:161144030-161144052 GCAGAGTCCCAAGGCTGAACAGG - Intergenic
984860529 4:184233907-184233929 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
985404184 4:189619942-189619964 GCAGCCTCCCAAATCAGAGAAGG + Intergenic
985606555 5:861218-861240 TCTGCCTCCCAATTCAGAACAGG + Intronic
985665935 5:1181546-1181568 GCAGCCTTCAAGGCCAGGACTGG - Intergenic
985766188 5:1780737-1780759 GCAGCCTTCCCAGCCATAGCAGG + Intergenic
985792180 5:1935256-1935278 CCATCCTCCCATGCCAGACCTGG + Intergenic
985823331 5:2175877-2175899 GCCGTCTCCAAAGCCAGAAGCGG - Intergenic
986620695 5:9670530-9670552 GCAGCCTCCTGAGCCAGAGTAGG - Intronic
986984804 5:13488413-13488435 GGAGAGTCCCAAGCCAGTACGGG - Intergenic
987137210 5:14911468-14911490 GCAGCCTCCTAAGCCAGAGTAGG + Intergenic
988680431 5:33479847-33479869 GCAGCCTCCTGAGCCAGAATAGG + Intergenic
989093432 5:37758345-37758367 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
989094170 5:37765910-37765932 GCAGCCTCCCAAGCCATAGTAGG + Intergenic
989601346 5:43203553-43203575 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
989990152 5:50754331-50754353 CCAGCCTCCCACCCCACAACAGG + Intronic
990317582 5:54598156-54598178 ACACCCTCCCAAGACTGAACTGG + Intergenic
991412752 5:66361165-66361187 GCAGCTTTCAAAACCAGAACAGG + Intergenic
991675253 5:69084325-69084347 GCTGCCTCCCGAGCCAGAGTAGG + Intergenic
992384125 5:76267339-76267361 GCAGCCTCCTGAACCAGAATAGG - Intronic
992422296 5:76618530-76618552 CCAGCCTTCCAAGGCAGAAAAGG + Exonic
992623278 5:78614313-78614335 GGAGACTCCCAAGCCAGAGAAGG - Intronic
993295612 5:86134970-86134992 GCAACTTCCCAAGCCAGAGTAGG + Intergenic
993806927 5:92422615-92422637 GCAGCCTCCCACACCAGAGTAGG + Intergenic
994115450 5:96056981-96057003 GCAGCCCCCAGAACCAGAACAGG + Intergenic
994209338 5:97070831-97070853 GCAGCCTCCCAAGACAGAGTAGG + Intergenic
994483745 5:100369025-100369047 CCAGCCCCCCAAGCCCCAACAGG + Intergenic
996601758 5:125272487-125272509 GCAGCCTCTCAAGCCAGAGTAGG + Intergenic
997256192 5:132430059-132430081 TCAGCCTCCCAACCCAGAGCAGG - Intronic
997423702 5:133788478-133788500 GTAGCCTCCCAAGCCCCAACTGG + Intergenic
997800320 5:136854198-136854220 GCAGGCTCCCCACCCAGAAGGGG + Intergenic
998004057 5:138645692-138645714 GCAGGCTCCCAAGCCAGAGTAGG + Intronic
998146522 5:139732112-139732134 CCAGCCTCTCAAACCAGATCAGG - Intergenic
999032004 5:148304377-148304399 GCAGCCTCCCTAGCAAGAGTAGG + Intergenic
999240587 5:150125151-150125173 TCAGCTTCCCCAGCCAGACCAGG + Intronic
999344260 5:150801335-150801357 ACAGTCTCTGAAGCCAGAACTGG - Intergenic
999379160 5:151108357-151108379 GCAGCCTCCGAAGCTACTACTGG - Intronic
999499205 5:152129958-152129980 CCAGACACCCAAGCCAGATCTGG + Intergenic
1000097991 5:157987675-157987697 GCTGCCACCCAAGCCAGAGCGGG - Intergenic
1000760562 5:165218661-165218683 ACAGCCTCCCCAGCCAGAGTTGG + Intergenic
1000820404 5:165975672-165975694 GCAGACTCCCAAGCCAGAATAGG - Intergenic
1000966857 5:167667905-167667927 GCAGCCTCCTAAACCAGAAGAGG + Intronic
1001683598 5:173576483-173576505 GCAGCCTCCCAAAGCTGAACAGG - Intergenic
1001849085 5:174947800-174947822 GGAGTCTCCCACTCCAGAACTGG - Intergenic
1001904286 5:175458501-175458523 GCAGTCTCCTAAACCAGAATAGG - Intergenic
1002012934 5:176298379-176298401 TCAGCCTCCCACTCCAGGACAGG - Intronic
1002214905 5:177624357-177624379 TCAGCCTCCCACTCCAGGACAGG + Intergenic
1003054715 6:2807750-2807772 GCAGGCACCCCAGCCAGAACAGG + Intergenic
1004198270 6:13525148-13525170 GCAGCCTCCGAAATCAGAAAAGG - Intergenic
1004361550 6:14975705-14975727 GCAGCCTTCCCAGCCAGAGTAGG - Intergenic
1004460339 6:15829276-15829298 GCAGCCTTCCAGGCCAGAGAAGG + Intergenic
1004670980 6:17796582-17796604 GCAGCCTCCTAGGCCAGAGTAGG + Intronic
1004765313 6:18720330-18720352 GCAGCTTTCCCAGCCAGCACAGG - Intergenic
1004901569 6:20199168-20199190 GCAGCCTCCCAAGCCGGAGTAGG - Intronic
1006290544 6:33132285-33132307 GCAGCCTCCCGAGGCAGAGTAGG + Intergenic
1006507664 6:34500268-34500290 GCAGCCTCCCAAACCAGAGTAGG - Intronic
1007974864 6:46091068-46091090 GCAGCATCCCCAACCAGAATAGG - Intergenic
1010243679 6:73642254-73642276 GCAGCCTCCCGAGCCATAGTAGG - Intronic
1010334361 6:74663421-74663443 ACAGCCTCCCAAGACTAAACCGG + Intergenic
1010720276 6:79275800-79275822 GCAGCCTTCCAAGCAAGAAGTGG + Intergenic
1011153308 6:84299792-84299814 GCAGTCTCCCGAGCCAGAGTAGG - Intergenic
1012843483 6:104360713-104360735 GCAGCCTCCTAAGCCAAAATAGG + Intergenic
1012849693 6:104431783-104431805 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1012947866 6:105487108-105487130 GCAGCCTCCCAAATCAGAAGAGG + Intergenic
1013121417 6:107144542-107144564 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1013186707 6:107765577-107765599 GCAGCCTCCTGAGCCAGAGTAGG - Intronic
1013412774 6:109896659-109896681 GCAGCCTCTCAGGCCAGAGTAGG - Intergenic
1013554184 6:111239866-111239888 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
1013680521 6:112520725-112520747 TTAGTCTCCCAAGCCAGAATAGG + Intergenic
1014117019 6:117676976-117676998 CCAGCCTTCCAAGACAGAAAGGG - Intronic
1014833509 6:126130454-126130476 GCAGGCTGCCCAGCCAGAACGGG + Intergenic
1015819814 6:137248824-137248846 GTAGCCTCCCAAGCTAGAGTAGG + Intergenic
1015854288 6:137606991-137607013 GCAGCCTCCTCAGCCAGACTGGG - Intergenic
1016423447 6:143909623-143909645 ACATCCTCCCAAGACTGAACAGG - Intronic
1016597400 6:145816719-145816741 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1017053946 6:150421099-150421121 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1017786701 6:157762679-157762701 GCATCCTCCCTAGCCACAGCGGG - Intronic
1018077042 6:160226638-160226660 GCAGCCTCCTGAGCCAGAGTAGG - Intronic
1018136823 6:160787145-160787167 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1018138630 6:160804708-160804730 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1018491668 6:164300156-164300178 GTAGTCTCCCAAGCCAGAGTAGG - Intergenic
1018948061 6:168359606-168359628 GCAGCCTCCCGAGCCAGAACAGG - Intergenic
1018984044 6:168622348-168622370 GCAGCCTCCCAAGCCAGAACAGG - Intronic
1019285328 7:220347-220369 GCAGCATCCCCAGCCACAGCAGG - Intronic
1020123448 7:5518801-5518823 TCAGCCTCCCAAGGGAGAGCTGG + Intergenic
1020696136 7:11415977-11415999 GCAGCCTCGCAAACCAGAACAGG - Intronic
1020836078 7:13153373-13153395 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1020846347 7:13289137-13289159 GCAGCCTCCTAAGCCAGAGTAGG - Intergenic
1020866840 7:13575144-13575166 GCAGCCTCCCCAGCCAGAGTAGG + Intergenic
1021436854 7:20628156-20628178 CCAGCCTCCCACCCCACAACAGG + Intronic
1021901193 7:25287533-25287555 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1022964482 7:35459720-35459742 GAAGTCTCACCAGCCAGAACTGG + Intergenic
1023041231 7:36174918-36174940 GCAGCCTCCCAAGCCAGAGTAGG + Intronic
1023806515 7:43876630-43876652 GCAGCCTCCTACACCTGAACTGG + Exonic
1024479358 7:49848145-49848167 GCAGCCTCCCCAGCCCCCACTGG - Intronic
1024691390 7:51806436-51806458 GCAGGCTGCCCAGCCAGCACTGG + Intergenic
1024840666 7:53583539-53583561 GCAGCCTCCCAAGCCAAAGTAGG - Intergenic
1024997910 7:55288358-55288380 GCAGCCTCCTGAGCCAGAATAGG - Intergenic
1028158580 7:87460239-87460261 GCAGACTCCCAGGCCACATCTGG - Intronic
1028749346 7:94365044-94365066 GCAGCCTCCCGAGCCAGAGTAGG - Intergenic
1029125357 7:98291735-98291757 TCTGCCTCCCAGACCAGAACGGG - Exonic
1029327736 7:99824158-99824180 GCAGTTTCCCCAGCCAGCACTGG - Intergenic
1029653411 7:101909143-101909165 TCGGCCTCCCAAACCTGAACTGG - Intronic
1029653424 7:101909194-101909216 TCGGCCTCCCAAACCTGAACTGG - Intronic
1029653437 7:101909245-101909267 TCGGCCTCCCAAACCTGAACTGG - Intronic
1029653450 7:101909296-101909318 TCGGCCTCCCAAACCTGAACTGG - Intronic
1030909391 7:115228004-115228026 ACAGCCTCCCGAGCCAGAGTAGG + Intergenic
1030942666 7:115673772-115673794 GCAGGCTCCCAAAGCAGAACTGG - Intergenic
1031217857 7:118920701-118920723 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1031497868 7:122473354-122473376 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
1031783492 7:125999093-125999115 GCAGCCTCCTGAGCCAGAGTAGG - Intergenic
1032019048 7:128396488-128396510 GGAGCCTACCATGGCAGAACAGG + Intronic
1033979753 7:147149034-147149056 GCAGCCACCCCAGCCAGCAGCGG - Intronic
1034366550 7:150554561-150554583 ACACCCTCCCAAGACAGAACCGG + Intergenic
1034864796 7:154631963-154631985 GCAGCCTCCTGAGCCACAATAGG + Intronic
1035495068 7:159317512-159317534 GCAGCCTCCCAAACCACAGCAGG - Intergenic
1035719859 8:1783878-1783900 GCAGCCTCCGGCGCCAGAGCTGG + Exonic
1036529728 8:9573251-9573273 GCAGCCTCCAGAGCCAGAATAGG + Intronic
1037150351 8:15627675-15627697 GCAGCTTCCCCGGCCAGCACTGG - Intronic
1037914021 8:22761125-22761147 GGAGCCTCCCCAGCAAGCACAGG + Intronic
1038157240 8:25001591-25001613 GCAGCTTCCCAAGGCAGAACAGG + Intergenic
1038293540 8:26270841-26270863 GCAGCCTCCCAAACGAGAATTGG + Intergenic
1038392865 8:27221130-27221152 GCAGCCTCCTGAACCAGAATAGG - Intergenic
1039332231 8:36550669-36550691 GCAGTCTCCCGAGCCAGAGTAGG - Intergenic
1039381272 8:37087720-37087742 GCAGCCTCCCAAACCAGGATAGG - Intergenic
1040803222 8:51366442-51366464 GCAGCCTCCTGAGCCAGAGCAGG - Intronic
1040997377 8:53415596-53415618 GCAGTCTTCCAAGCCAGAGTAGG + Intergenic
1041474468 8:58248707-58248729 GCAGCCGCCCAAGCAGGCACTGG + Intergenic
1042158833 8:65871593-65871615 GCAGTCTCCCAAGCCAGAATAGG - Intergenic
1042545951 8:69951630-69951652 GCAGCCTCCCGAGCCAGAGTAGG - Intergenic
1042781304 8:72494082-72494104 GCAGCCCCCAAAACCAGAATAGG + Intergenic
1042960584 8:74299591-74299613 GCAGCCACCCGAGCCAGAGTGGG - Intronic
1043276300 8:78399345-78399367 ACATCCTCGGAAGCCAGAACAGG - Intergenic
1043364440 8:79516218-79516240 CCAGCCTCCCACCCCACAACAGG + Intergenic
1043586824 8:81779565-81779587 TGAGCCTCCCAAAACAGAACTGG - Intergenic
1043878105 8:85509358-85509380 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
1043910733 8:85860635-85860657 GCAGCCTCCCGAGCCAGAGTAGG + Intergenic
1044455966 8:92393494-92393516 ACAGCCACCCGAGCCAGCACCGG - Intergenic
1044500466 8:92949134-92949156 GAAGCCTCCCAGGCCAGAATAGG - Intronic
1044992329 8:97807121-97807143 GTAGGCTCCGAAGCCAGAAGAGG + Intronic
1045733609 8:105269335-105269357 ATAGCCTCCCAAGCCAGAATAGG + Intronic
1046720234 8:117610944-117610966 GCAGCCTTCTGAGCCAGAATAGG + Intergenic
1046955684 8:120060752-120060774 GCAGCCTCCTAAGTCTGTACAGG + Intronic
1047037602 8:120956548-120956570 GCAGCCTCTCAAGCCAGAGTAGG - Intergenic
1047212270 8:122849525-122849547 GCAGCACCCGAAGCCAGAAGAGG - Intronic
1048085561 8:131174594-131174616 GCAGCCTCCCAAGCCAGAATAGG + Intergenic
1049384450 8:142334272-142334294 GCAGCCTCCCGAACCAGAGTAGG - Intronic
1050165605 9:2761745-2761767 GTAGCCTCCTGAGCCAGAGCAGG - Intronic
1050603465 9:7275988-7276010 GCAGTATCCCAAGTCAGCACTGG + Intergenic
1050727465 9:8667918-8667940 GCAACTTCTCAAGCCAGAATAGG - Intronic
1052032530 9:23644778-23644800 GCTGCCACCTAAACCAGAACTGG + Intergenic
1053251831 9:36580653-36580675 GTAGCCTCCCGAGCCAGAGTAGG + Intronic
1053534972 9:38916303-38916325 GCAGCCTTCCCAGCCAGACTAGG - Intergenic
1053542736 9:38992013-38992035 GAAACCTCACAAGCCAGAAGAGG - Intergenic
1053807186 9:41815530-41815552 GAAACCTCACAAGCCAGAAGAGG - Intergenic
1054207191 9:62140725-62140747 GCAGCCTTCCCAGCCAGACTAGG - Intergenic
1054623406 9:67371897-67371919 GAAACCTCACAAGCCAGAAGAGG + Intergenic
1054631160 9:67447629-67447651 GCAGCCTTCCCAGCCAGACTAGG + Intergenic
1054771346 9:69087119-69087141 GCAGCCTCCTCAGCCAGAGTAGG - Intronic
1054928075 9:70608203-70608225 GCAGTCTTCCAAGCCAGAGTAGG - Intronic
1055533446 9:77211543-77211565 GCAGCCTCCCAAGCCAGAGCAGG + Intronic
1055534400 9:77223081-77223103 GCAGCCTCCAGAGCCAGAAGAGG - Intronic
1057249950 9:93493056-93493078 TCAGCCTCCCGGGCCAGAGCAGG - Intronic
1057551662 9:96055519-96055541 GCAGCCTTCCCAGCCAGAGTAGG + Intergenic
1057914231 9:99043330-99043352 GCCTCCTCCCAAGCCTGAGCTGG - Intronic
1058218194 9:102261109-102261131 GCAGCCTCCTGAGCCAGAATAGG - Intergenic
1058506608 9:105672991-105673013 GCAGCCTTCCGAGCCAGAGCAGG + Intergenic
1060651959 9:125335693-125335715 ACAGCCTCCCAAACCAGAGTAGG + Intronic
1061114907 9:128603934-128603956 GCAGACTCTCAGGCCAGAGCAGG - Intronic
1061597933 9:131644366-131644388 ACAGCCTCCCAAACCAGAACAGG - Intronic
1061749158 9:132763739-132763761 GCAGCCCCCCAAACCAGAACAGG - Intronic
1061791027 9:133058949-133058971 GCAACCAGCCAATCCAGAACAGG - Intergenic
1062375519 9:136260179-136260201 GCAGCCTCCGAGGCCAGCATGGG - Intergenic
1185862119 X:3589580-3589602 GCTGACTCCCAAGCCAGAGTCGG + Intergenic
1186031574 X:5374705-5374727 GCAGCCTCCCAAGCCAGCGTAGG - Intergenic
1186192267 X:7077273-7077295 GCAGCATGGCAAGCCAGACCCGG - Exonic
1186390050 X:9149767-9149789 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
1187936765 X:24343802-24343824 GCAGCTTCCCCAGCCAGAATAGG + Intergenic
1187937206 X:24347451-24347473 GCAGCCTCCGGAGCCAGAATAGG + Intergenic
1188157018 X:26752625-26752647 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
1188157600 X:26758971-26758993 GCAGCCTCCTAAGCCAGAGTAGG + Intergenic
1188936738 X:36185213-36185235 GCATCCTCCCATGGCAGAAGGGG + Intergenic
1188946712 X:36314341-36314363 GCAGCCTCCAAAGCCAGAGTAGG + Intronic
1190231682 X:48587121-48587143 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1191615054 X:63162061-63162083 GCAGCCTCCCTGGCCAGGATTGG + Intergenic
1191621244 X:63216862-63216884 GCAGCCTCCCTGGCCAGGATTGG - Intergenic
1191638081 X:63399995-63400017 GCAGCCTCCTGAGCCAGAGTAGG + Intergenic
1192283434 X:69708183-69708205 GCAGCCCTCAAAACCAGAACAGG + Intronic
1192944546 X:75951047-75951069 GCGGCCTCCCAAGCCAGAGTAGG + Intergenic
1193095247 X:77541245-77541267 GCACCCTCCCAAGTCTAAACCGG + Intronic
1193987945 X:88269832-88269854 GCAGTCTCTCTAGCCAGAAAGGG - Intergenic
1194138613 X:90179321-90179343 GCAGCCTCCTGAGCTAGAGCAGG + Intergenic
1194569583 X:95537836-95537858 GCAGCCTCCCAAATCAGAGTAGG + Intergenic
1196893553 X:120311622-120311644 CCAGCCTTCCAAGCCAGACAGGG + Intergenic
1197001549 X:121445721-121445743 GCAGCCTCTTTAGCCAGAAAAGG + Intergenic
1197452640 X:126639193-126639215 GCAGCCTCCTAAGCTAGAGTAGG - Intergenic
1197796824 X:130306711-130306733 GCAGCCTCCCTGGCCAGGATTGG - Intergenic
1198949444 X:142054117-142054139 GCAGCCTCCCAAGCCATAGTAGG + Intergenic
1199038680 X:143084181-143084203 GCAGCCAACCAAGGCAGGACTGG + Intergenic
1199418028 X:147609241-147609263 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1199901852 X:152181664-152181686 CCAGCCTCCCACCCCACAACAGG - Intronic
1200269162 X:154665280-154665302 CCAGCCCCCCAACCCACAACAGG + Intergenic
1200484415 Y:3749556-3749578 GCAGCCTCCTGAGCTAGAGCAGG + Intergenic