ID: 1018986722

View in Genome Browser
Species Human (GRCh38)
Location 6:168643419-168643441
Sequence CCTGAGGCCCTGAGGATACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 234}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018986722_1018986727 -5 Left 1018986722 6:168643419-168643441 CCTGGTATCCTCAGGGCCTCAGG 0: 1
1: 0
2: 1
3: 40
4: 234
Right 1018986727 6:168643437-168643459 TCAGGAATGCCACACTGCCTGGG No data
1018986722_1018986729 3 Left 1018986722 6:168643419-168643441 CCTGGTATCCTCAGGGCCTCAGG 0: 1
1: 0
2: 1
3: 40
4: 234
Right 1018986729 6:168643445-168643467 GCCACACTGCCTGGGACGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 263
1018986722_1018986733 13 Left 1018986722 6:168643419-168643441 CCTGGTATCCTCAGGGCCTCAGG 0: 1
1: 0
2: 1
3: 40
4: 234
Right 1018986733 6:168643455-168643477 CTGGGACGCAGGGTCTTCGTGGG 0: 1
1: 0
2: 1
3: 7
4: 112
1018986722_1018986732 12 Left 1018986722 6:168643419-168643441 CCTGGTATCCTCAGGGCCTCAGG 0: 1
1: 0
2: 1
3: 40
4: 234
Right 1018986732 6:168643454-168643476 CCTGGGACGCAGGGTCTTCGTGG No data
1018986722_1018986728 2 Left 1018986722 6:168643419-168643441 CCTGGTATCCTCAGGGCCTCAGG 0: 1
1: 0
2: 1
3: 40
4: 234
Right 1018986728 6:168643444-168643466 TGCCACACTGCCTGGGACGCAGG 0: 1
1: 0
2: 1
3: 14
4: 224
1018986722_1018986726 -6 Left 1018986722 6:168643419-168643441 CCTGGTATCCTCAGGGCCTCAGG 0: 1
1: 0
2: 1
3: 40
4: 234
Right 1018986726 6:168643436-168643458 CTCAGGAATGCCACACTGCCTGG 0: 1
1: 1
2: 0
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018986722 Original CRISPR CCTGAGGCCCTGAGGATACC AGG (reversed) Intronic
900094993 1:936621-936643 CCCGAGGCCCTGTGGACCCCAGG + Intronic
900255070 1:1693575-1693597 CCTGCGGCCCCGAGGACCCCCGG + Intronic
900263813 1:1746841-1746863 CCTGCGGCCCCGAGGACCCCCGG + Intergenic
900322108 1:2089975-2089997 CCGGAGGCCGTGAGGAGCCCGGG + Intronic
900391121 1:2434380-2434402 CCAGAGGCCCTGTGGGTGCCCGG - Intronic
900744734 1:4353209-4353231 GCTGAGGCCTTGAGGATGCTGGG - Intergenic
901069253 1:6509109-6509131 CCAGAGGCCGTGAGGCTTCCAGG - Intronic
901232726 1:7650160-7650182 CCTGAGGCTCTGACGCTGCCAGG + Intronic
901560800 1:10068757-10068779 CCTGAGGCCCTGGGAATATCTGG - Intronic
901661066 1:10798149-10798171 CCTCTGGCCCTGAGGAGGCCAGG + Intergenic
902410223 1:16207841-16207863 CCTGAGGCCGTCAGGGTGCCTGG - Intronic
902767784 1:18628704-18628726 CCTGAGGTTCTGAGGGTCCCTGG + Intergenic
903785977 1:25861645-25861667 CCTAAGACCCTGAGGGTCCCAGG + Exonic
908480656 1:64535803-64535825 CCAGAGGCCCAGAGGAAGCCAGG - Intronic
909512525 1:76470748-76470770 ACTGAGGCCAAGAGAATACCTGG + Intronic
909638445 1:77844755-77844777 CCTGAGGCCCTGAGGTCAGGAGG + Intronic
910139192 1:84008006-84008028 TCTGAGGCTCTGAGAGTACCAGG - Intergenic
918233495 1:182557062-182557084 CCTGAGACTCTGAGGTCACCTGG + Intronic
920268411 1:204744283-204744305 GCTGAGCCCCTGAGGGGACCAGG + Intergenic
922160941 1:223078857-223078879 TATGAGGCCCTCAGGAAACCTGG + Intergenic
922217907 1:223535585-223535607 TCTGAGCCTCTGAGGATGCCAGG - Intergenic
922392115 1:225155547-225155569 CCAGAGGACTTGAGGATATCAGG - Intronic
1063487591 10:6434509-6434531 ACTGAGGTCCTGAGGATGACAGG + Intronic
1063629522 10:7720986-7721008 CCAGAGGCCCTGTGAATGCCTGG - Intronic
1064099539 10:12451460-12451482 ACTGGGTCCCTGGGGATACCAGG - Intronic
1064853193 10:19733946-19733968 CCTGAGGACCCCAGGATACATGG + Intronic
1068266490 10:54656683-54656705 CCTGAGGAACTGTGGATCCCTGG + Intronic
1068689523 10:59901701-59901723 CCTGAGGCCCTGCTTATACACGG + Intronic
1069695046 10:70380445-70380467 CCTGAGCTCCTCAGGGTACCTGG + Intronic
1071754823 10:88525907-88525929 CCTAAGGGGCTGAGGAGACCTGG - Intronic
1074423052 10:113326459-113326481 CCTGAGTCCCTGAGGAAATCTGG + Intergenic
1074535851 10:114328315-114328337 CCATAGGCCCTGAGGACCCCAGG + Intronic
1074719282 10:116250754-116250776 CCAGGGGTCCTGAGGACACCAGG - Intronic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1077152102 11:1077117-1077139 TCAGAGGCCCTGAGGGCACCAGG - Intergenic
1077187283 11:1240969-1240991 CCTGAGGCAGAGAGGGTACCAGG + Exonic
1080268621 11:30426805-30426827 CCTGAGGCCAGGAGGTGACCTGG + Intronic
1081805359 11:45886992-45887014 CCTGAGGCCCTGAGCTGAGCTGG + Intronic
1084171070 11:67401377-67401399 CCCGAGGCGCTGAGGGTAGCTGG - Intronic
1085025348 11:73233211-73233233 CCTGAGCCTGTGAGGCTACCAGG - Intronic
1085522550 11:77146878-77146900 CCCAGGGCCCTGAGGAAACCAGG + Intronic
1085823072 11:79813914-79813936 CTTGAAGTCCTGAGGATACATGG - Intergenic
1086420160 11:86630886-86630908 CAGGAGCCCCTGAGGAAACCTGG + Intronic
1087189058 11:95232720-95232742 CCTGAATCCCTAAGGAAACCAGG - Intergenic
1089746568 11:120621569-120621591 CATAAGCCCCTGAGGATGCCAGG - Intronic
1090660694 11:128879898-128879920 CCTGCGGCCCTCAGGGTCCCTGG - Intergenic
1090702373 11:129308343-129308365 CCTGAGACAGTGAGAATACCAGG + Intergenic
1091282869 11:134391842-134391864 TCTGAGGCTCTGAGGGCACCCGG - Exonic
1091603352 12:1930898-1930920 CCTGTGGCCCTGAGGGGAGCTGG - Intergenic
1095152899 12:38816941-38816963 CCTGATGCACTGAGTCTACCTGG + Intronic
1095633996 12:44409800-44409822 CATGAGAACCTGAGGATTCCTGG - Intergenic
1096368416 12:51048021-51048043 CCTGAGGCCCTAAGGAATCGCGG + Intronic
1097287556 12:57889496-57889518 CCTGAGGCCCAGAGGGAAGCAGG + Intergenic
1097677474 12:62618589-62618611 GCTGAGGCCCTGAAGTCACCAGG - Intergenic
1097787788 12:63780070-63780092 CCTGAGGCCCCGCGGGGACCCGG - Exonic
1099202196 12:79690318-79690340 CCTGCGGCCCCGAGGATGCCAGG + Exonic
1100679847 12:96907309-96907331 CCGGAGGCCCTGAGGTCAGCGGG + Intronic
1101637951 12:106561818-106561840 CCTGAGGCCCTCATCAGACCCGG + Intronic
1103513453 12:121490934-121490956 ACTGAGGCCCTCAGGATGCGAGG - Intronic
1103920127 12:124395043-124395065 CCGAAGGCCCTGGGGAAACCTGG + Intronic
1103935623 12:124475011-124475033 ACAGAGGCCCTGAGGATGGCAGG - Intronic
1104571491 12:129929856-129929878 CCAGAGGTCGTGAGGAAACCAGG - Intergenic
1105673097 13:22642356-22642378 CCTGGGGCCCTGTGCAGACCAGG + Intergenic
1106119717 13:26849953-26849975 CCTGAGGACATGAGGCTCCCGGG + Intergenic
1106362926 13:29049329-29049351 CATGAGGCCCTTAGGATAGCGGG + Intronic
1106798896 13:33235666-33235688 ACTGAGGCCTTGAGGACACCAGG + Intronic
1107675594 13:42793586-42793608 ACTGAGGCCCTGAGTCCACCAGG - Intergenic
1109436657 13:62312292-62312314 CTTGATGCCCTCAGAATACCAGG + Intergenic
1112361541 13:98723556-98723578 CCTGGAGTCCTGAGGACACCTGG + Intronic
1112590574 13:100760399-100760421 CTTAAGGCCCTGGGCATACCTGG - Intergenic
1113047161 13:106168439-106168461 CCTGCAGCCCTCAGCATACCGGG + Intergenic
1113208151 13:107941630-107941652 CTTGTTGCCATGAGGATACCAGG + Intergenic
1113388511 13:109873475-109873497 CCCGAGGCCCCCAGGAAACCAGG - Intergenic
1113627335 13:111856773-111856795 CCCGAGGCCCTGAGTGCACCCGG + Intergenic
1113656842 13:112072835-112072857 CCCGAGGCCCCGAGGAGGCCCGG - Intergenic
1113742931 13:112723887-112723909 CCTCAGGGCCTGTGGATTCCCGG + Intronic
1113772656 13:112920579-112920601 CCTGCTGCCCTGCGGTTACCGGG + Intronic
1113932349 13:113975044-113975066 CCTGAGGTCCTGAGGGTCACAGG + Intergenic
1114618570 14:24081623-24081645 CCTGAGGGCCCGACGCTACCTGG + Intronic
1115321180 14:32080673-32080695 CCAGAGGTCCTGAGGAAAACAGG - Intronic
1120155488 14:81088647-81088669 CCTCAGGCCCCCTGGATACCAGG + Intronic
1121436713 14:93925461-93925483 CCTGAGGGCCTGTGGCCACCAGG - Intronic
1122564585 14:102643561-102643583 CCTGGGCCTCTGAAGATACCTGG - Intronic
1122784788 14:104158658-104158680 CCTGAGGCCCTGCAGGCACCAGG + Intronic
1122883590 14:104700782-104700804 ACTGAGGCCCAGGGGAGACCTGG + Intronic
1124620529 15:31271482-31271504 CCAGAGGCCCTTGGGATAGCAGG + Intergenic
1124641087 15:31397182-31397204 CCTGAGGCCCTGAGGCCAAGAGG + Intronic
1124983686 15:34584840-34584862 CCTGAGACCCTGAGGAGAACGGG + Intronic
1125826938 15:42684604-42684626 CCTGGGTCCATGAGGATACAAGG - Exonic
1127033945 15:54894724-54894746 CCCAAGTCCCTGAGAATACCTGG - Intergenic
1129966872 15:79743775-79743797 CCTGGGGCCCTGCTGATAGCTGG - Intergenic
1130153720 15:81332263-81332285 GCTGAGGCCCTGAGGCTGACAGG - Exonic
1133003742 16:2865682-2865704 ACTGAGGCCCAGATGATCCCGGG - Intergenic
1133317493 16:4893498-4893520 CCTGAGGCTCTGGGGGTACCGGG - Intronic
1135630612 16:24033222-24033244 CCTGAGGCCCAGAGGACAGAGGG + Intronic
1136124640 16:28169091-28169113 CGTGAGGCCCTGAGGGTGCCGGG - Intronic
1137001337 16:35233345-35233367 CCTTATGCCCTGAGGCTATCAGG - Intergenic
1139224030 16:65216789-65216811 TCTGAGGCCCTGAGCATTTCAGG - Intergenic
1141481226 16:84308208-84308230 TCTCAGGCCCTGAGGCTCCCTGG + Intronic
1142284972 16:89167944-89167966 CCTGAGGACCTGGGGACAGCAGG - Intergenic
1142505085 17:358068-358090 CCTGGGGCCCTGGGGATAGCAGG - Intronic
1143378448 17:6480786-6480808 CCTGGGGCCGGGTGGATACCTGG - Intronic
1143407400 17:6686498-6686520 CCTTGAGCACTGAGGATACCTGG - Intronic
1143447009 17:7015591-7015613 CTTGAGGCCCTGCGGGAACCGGG - Intronic
1143683762 17:8497090-8497112 GCTGAGGTGCTGAGGAAACCAGG - Intronic
1143921877 17:10336667-10336689 CCTGGGGCCCTGAGGTGACCAGG - Intronic
1144739055 17:17571021-17571043 CCTGAAGCCCTGAGGAGTCCAGG + Intronic
1144875022 17:18393061-18393083 TCTGTGGCCCTGAGCATCCCAGG + Intergenic
1145157202 17:20551360-20551382 TCTGTGGCCCTGAGCATCCCAGG - Intergenic
1146352383 17:32105432-32105454 CCTGAGGCCCTGAGTGGACCTGG - Intergenic
1146833484 17:36090269-36090291 CCTGAGCCCCTGTGGTCACCAGG - Intergenic
1146844736 17:36175447-36175469 TCTGAGGCCCTGAGCATCCCAGG - Intronic
1146848020 17:36196886-36196908 CCTGAGCCCCTGTGGTCACCAGG - Intronic
1146857042 17:36263382-36263404 GCTGAGGCCCTGAGCATCCCAGG - Intronic
1146863575 17:36324993-36325015 GCTGAGGCCCTGAGCATCCCAGG + Intronic
1146872952 17:36387292-36387314 GCTGAGGCCCTGAGCATCCCAGG - Intronic
1146880310 17:36438378-36438400 TCTGAGGCCCTGAGCATCCCAGG - Intronic
1147066435 17:37925581-37925603 GCTGAGGCCCTGAGCATCCCAGG + Intronic
1147075836 17:37987917-37987939 GCTGAGGCCCTGAGCATCCCAGG - Intronic
1147077967 17:38005142-38005164 GCTGAGGCCCTGAGCATCCCAGG + Intronic
1147087361 17:38067463-38067485 GCTGAGGCCCTGAGCATCCCAGG - Intronic
1147093903 17:38129077-38129099 GCTGAGGCCCTGAGCATCCCAGG + Intergenic
1147103305 17:38191426-38191448 GCTGAGGCCCTGAGCATCCCAGG - Intergenic
1147205539 17:38834847-38834869 CCTGGGGCCCTGCTGATAGCTGG + Intergenic
1147247576 17:39132394-39132416 TCTGAGGCCCTGGGGACACTGGG - Intronic
1147324180 17:39662557-39662579 CCTGAGGCCCTGAGGAAGGGTGG + Intronic
1148786859 17:50149810-50149832 CCTGCGGCCCTGGGGAGCCCGGG + Exonic
1149295430 17:55257781-55257803 TCTGATCACCTGAGGATACCTGG + Intergenic
1149567225 17:57648854-57648876 CCCCAGGCCCTGAGGAGGCCGGG - Intronic
1149847880 17:60017895-60017917 TCTGAGGCCCTGAGCATCCCAGG - Intergenic
1150086236 17:62274512-62274534 TCTGAGGCCCTGAGCATCCCAGG - Intronic
1150441926 17:65198158-65198180 CCTAAGGCCCTGAAGAAATCAGG - Intronic
1150490970 17:65574073-65574095 CCTGATGCCCAGGGAATACCTGG + Intronic
1151801000 17:76379752-76379774 CCAGAGGCCCAGAAGAGACCTGG + Intronic
1152028515 17:77827008-77827030 TCTGAGGCCCTGAAGGTCCCAGG - Intergenic
1152537619 17:80959811-80959833 CCTGAGGCCCTGAGGCGCCTGGG - Intronic
1154503134 18:15006231-15006253 CCTGAGGCCCTCAGGTGACAGGG + Intergenic
1156377584 18:36528628-36528650 CCTGTGGCCCTCTGGATACTGGG + Intronic
1157187782 18:45555015-45555037 CCTGTTGCCTTTAGGATACCAGG + Intronic
1157503205 18:48205050-48205072 CCCAGGGCCCTGAGGATCCCTGG - Intronic
1161196924 19:2992014-2992036 TCTGAGGACCAGAGGATGCCTGG - Intronic
1161473733 19:4473446-4473468 CCTGAGGGCCTGGGGATCCCAGG + Intronic
1161594571 19:5144552-5144574 CCTGGGGCCCTGAGGACAAGGGG - Intronic
1161981266 19:7631671-7631693 CCTGAGGGCCTGAGGCATCCTGG - Exonic
1162019963 19:7863868-7863890 CCCGGGGCCCTGAGGAGCCCAGG - Intronic
1162114689 19:8421806-8421828 CCTCAGGCCCTGAGGATACGGGG + Exonic
1163540029 19:17902977-17902999 GCAGAAGCCCAGAGGATACCCGG - Intergenic
1164458360 19:28427354-28427376 CCTTCGGCTCAGAGGATACCAGG - Intergenic
1164769288 19:30795837-30795859 ACTGAGGGACTGAGGATGCCTGG + Intergenic
1165562264 19:36689810-36689832 CCTCAGACCCTGAGGCCACCAGG - Intronic
1165694424 19:37889787-37889809 CTTATGGCCCTGAGGATATCTGG - Exonic
1166786491 19:45370337-45370359 CCTGAGGACCTGAGGGTTACCGG - Intronic
1167156188 19:47740814-47740836 CCTGAGGCCCTCAGGCTGCAAGG - Intronic
1167491232 19:49793557-49793579 CCTGAGGCCTTGTGCATGCCAGG + Intronic
926072294 2:9907515-9907537 CCCGAGCCCCAGAGGCTACCTGG - Intronic
926103524 2:10136244-10136266 GTTGAGGCCCAGATGATACCAGG + Intergenic
926690550 2:15730509-15730531 CCTGAGACCCTGAGGTTTCAGGG + Intronic
927815232 2:26209994-26210016 CCTGAGTCCCTGGGGATGCGGGG + Intronic
932720742 2:74137667-74137689 CCTGAGGTCCTGGCCATACCTGG + Intronic
932721732 2:74143614-74143636 GCTGAGGCCTTGATGTTACCAGG - Intronic
933852952 2:86385571-86385593 CCTGAGGCCCTGGGAATGCATGG + Intergenic
935205128 2:100890509-100890531 CCTGATGACCTGAGGGTACAGGG - Intronic
937311460 2:120905820-120905842 GCTGTTGCCCTGAGGTTACCAGG + Intronic
938502304 2:131836401-131836423 CCTGAGGCCCTCAGGTGACAGGG + Intergenic
940163689 2:150743340-150743362 TCTGAGACCTTGAGGATGCCGGG - Intergenic
945437381 2:209834942-209834964 CCTCAGGTGCAGAGGATACCTGG - Exonic
947156203 2:227164674-227164696 CCTGAGAGCCTGAGGGTCCCCGG + Exonic
948808539 2:240463296-240463318 CCCGAGGCCCTGGGGGTGCCTGG - Intronic
1169422105 20:5469139-5469161 CCTGAGACCCTGAGCACACAGGG - Intergenic
1170284074 20:14685654-14685676 CCTCAGGCCCTGAAGATTACAGG - Intronic
1172208568 20:33181764-33181786 CCAGGGGCCCTGAGGATTCTTGG + Intergenic
1172753806 20:37269604-37269626 CCTGAGACCCTTGGGATGCCTGG + Intergenic
1172759549 20:37312403-37312425 CCTGAGGGCCCCAGGAAACCTGG + Intronic
1174004904 20:47402782-47402804 TCTGAGGCTCTGAGGGTACAAGG + Intergenic
1174534384 20:51239485-51239507 ACTGAGCCCATGAGGCTACCAGG + Intergenic
1175532832 20:59685718-59685740 CCTGAGGCCCGAAGGATAATGGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1176109531 20:63405101-63405123 CCTGAGGCCCTGAGGCCAGCAGG - Intergenic
1176239807 20:64070666-64070688 CCAGATGCCCTGAAGACACCGGG - Intronic
1176307242 21:5130190-5130212 GCTCAGGCCCTGATGACACCAGG - Intergenic
1177771452 21:25520218-25520240 CCTAAGTCCCTTAGAATACCTGG + Intergenic
1179849817 21:44131840-44131862 GCTCAGGCCCTGATGACACCAGG + Intergenic
1181174523 22:21028135-21028157 ACTGAGGCCCTGCAGCTACCAGG + Exonic
1181484272 22:23220556-23220578 TCTGAGGCCCTGAGGCTGCCTGG + Intronic
1181573468 22:23780224-23780246 GCTGAGGCCCAGAGTACACCTGG + Intronic
1182194800 22:28505584-28505606 CCTCAGGAGCTCAGGATACCAGG + Intronic
1183322699 22:37174852-37174874 CCTGTGGCCCTGAGGGAAGCTGG + Intronic
1185007316 22:48288739-48288761 CAGGAGGCCCTGAGGACGCCCGG - Intergenic
1185210111 22:49565878-49565900 CATGAGGCCTTGAGGCCACCAGG + Intronic
950018144 3:9768559-9768581 CCAGAGGCCCTAATGACACCTGG + Intronic
950548190 3:13651452-13651474 CCTGAGGCCTGCAGGACACCGGG + Intergenic
952411419 3:33053209-33053231 CCTGAGGACCAGATGAGACCAGG + Intronic
953765795 3:45740918-45740940 CCTGAGAACCTGAGGAGACAAGG + Intronic
959359295 3:105368338-105368360 CAGGCGGGCCTGAGGATACCAGG - Intronic
960781895 3:121329308-121329330 CCTGCTGACCTAAGGATACCTGG + Intronic
961532264 3:127547058-127547080 CCTGAGGCCTTGTGGATAGCAGG + Intergenic
961818001 3:129561238-129561260 CCCGAGACCCAGAGGATCCCGGG + Intronic
963061160 3:141228144-141228166 CCTGAGGCCCTGCAGTTGCCAGG + Intergenic
963483215 3:145903725-145903747 CCTGAGGCCACAGGGATACCTGG - Intergenic
964339927 3:155697700-155697722 CCTGTGCCCCTGAGGACACTGGG - Intronic
964356217 3:155854188-155854210 CTAGAGGCCCAGAGGATGCCTGG + Exonic
968861728 4:3176806-3176828 CCAGAGGCTCTGAGAAAACCAGG + Intronic
968940403 4:3634654-3634676 CCTGAGGACCTGAGCTGACCAGG + Intergenic
969681178 4:8644332-8644354 CCTGAGGCCCTGAGGAACGAGGG - Intergenic
972934305 4:44113746-44113768 CCCAAGTCCCTGAGAATACCTGG - Intergenic
982276205 4:153639415-153639437 CCTCAGACCCTGAGAATAGCTGG + Intergenic
986306604 5:6521099-6521121 CCTGATGCCAGGGGGATACCTGG + Intergenic
986450000 5:7853952-7853974 TGTGAGGCCCTGAGGATGCAGGG + Intronic
987324955 5:16804257-16804279 GGTGAGGCCCTGAGCAGACCAGG - Intronic
988529657 5:32016577-32016599 CCTGAGGCCTTGAGGATAGAGGG + Intronic
994451485 5:99950227-99950249 CCTGAGGCTCTGAGAGTACAAGG - Intergenic
995526018 5:113051183-113051205 CGTGGGGCCCTGAGGATCCTGGG - Intronic
996518663 5:124401639-124401661 CCTGAGGCAATGAGGAAATCAGG - Intergenic
996581599 5:125037661-125037683 GGTGAGGCCCAGAGGAAACCAGG - Intergenic
997300417 5:132799622-132799644 CCTGAGGCTGTGAGGAGATCTGG - Intronic
998095981 5:139395697-139395719 CCTGAGGCCCTGAGGAGTCAGGG - Exonic
999154570 5:149449450-149449472 CCTGAGGCCCTGAAGCAAGCAGG + Intergenic
999287997 5:150405601-150405623 CCTGAAGCCATGGGGATCCCAGG - Intronic
1001440659 5:171740293-171740315 GCTGAGGCCCTGTGGTTACAAGG + Intergenic
1001572691 5:172740912-172740934 CCTGGGGCCCTGGAGACACCAGG + Intergenic
1003175989 6:3752253-3752275 CCTGAGGCACGGAGGGAACCCGG - Intergenic
1005754103 6:28910266-28910288 CCTGAGTCTCTGAGGATCACTGG + Intronic
1005822752 6:29611116-29611138 CCTGAGGCCCTAAGGATGCTTGG + Intronic
1006021090 6:31118038-31118060 ACTGAGGCTCTGAGGAGTCCAGG + Intronic
1007369839 6:41419479-41419501 AGAGAGGCCCTGAGGATGCCTGG + Intergenic
1007487360 6:42190641-42190663 CCTGAGACCCAGAGGTTCCCAGG + Intronic
1007622638 6:43224253-43224275 CCTCTGGCCCTGAGGAGGCCTGG - Exonic
1007716296 6:43858100-43858122 CCTGGGGACCTGAGGAAAGCTGG - Intergenic
1012386585 6:98690059-98690081 CCTGAGGCCCTCAGCAGAGCAGG - Intergenic
1012421873 6:99074691-99074713 CAGGAGGCTCAGAGGATACCGGG + Intergenic
1017778098 6:157695296-157695318 CCTGGAGCTCTGAGGATACCAGG + Intergenic
1018067663 6:160134852-160134874 GCTGAGGCCCTGAGTTTTCCTGG - Intronic
1018385089 6:163295942-163295964 CCTGAGGCCCTGAGTAGCCCTGG + Intronic
1018635786 6:165858271-165858293 GCTGAGGGCCTGAGGAAAGCTGG - Intronic
1018754658 6:166838701-166838723 GGTGAGGCCTTGAGGATACCTGG - Intronic
1018867266 6:167755964-167755986 GCAGAGGCCCTGATGTTACCGGG + Intergenic
1018968050 6:168503977-168503999 CTTGAGGACCTGAGGAGACCGGG - Intronic
1018986722 6:168643419-168643441 CCTGAGGCCCTGAGGATACCAGG - Intronic
1019163249 6:170082857-170082879 CCTGTGGCCCTGAGCAGTCCTGG - Intergenic
1019266620 7:120799-120821 CCAGAGGCCCTGAGGGGTCCGGG - Intergenic
1020098436 7:5381129-5381151 CTTGAGGCCCTGAGGGTGGCAGG - Intronic
1021269421 7:18566961-18566983 CCTCAGGTCCTGAGGTTATCAGG + Intronic
1021887740 7:25156598-25156620 CCTGTGGCACGGAGGATACTGGG + Intronic
1022727349 7:32993010-32993032 TCTCAGGCCCCGAGGATTCCAGG - Intronic
1025046231 7:55694639-55694661 TCTCAGGCCCCGAGGATTCCAGG + Intergenic
1029159305 7:98540553-98540575 CCTGGGGCCCTGGGGCTGCCTGG + Intergenic
1034259506 7:149745986-149746008 GCTGAGGCCCTGAGAATTGCAGG + Intergenic
1034432660 7:151048896-151048918 CCTCAGGCCCAGAGGAGGCCCGG + Exonic
1034897570 7:154887236-154887258 CCTGAGGCCCTGCGGTCAGCTGG - Intronic
1034986983 7:155522392-155522414 CCTTAGGCCACGAGGAAACCAGG - Intronic
1035247900 7:157576837-157576859 CCTCAGGCACTGAGGAACCCAGG + Intronic
1035302212 7:157904934-157904956 CCTGAGACCCACAGGATGCCGGG - Intronic
1035397880 7:158546930-158546952 CCTGGGGCCCTGAAGATGGCTGG - Intronic
1040060943 8:43102367-43102389 CTTGAGAACCTGAGGAAACCTGG + Intronic
1041514808 8:58689168-58689190 CCTGAGGCCTGGATGATTCCTGG + Intergenic
1045137075 8:99232880-99232902 GCAGAGGCCCTGAGAATCCCAGG - Intronic
1045371621 8:101529822-101529844 CCACAGGCTCTGAGGATGCCTGG + Intronic
1046702754 8:117419200-117419222 CCTGTGGCTCTGAGGAATCCGGG + Intergenic
1047879264 8:129175259-129175281 ACTGAGGCCCTGAGAAGAACTGG + Intergenic
1048272838 8:133043244-133043266 CATGAGGCCATGAGGCTACCAGG - Intronic
1048616569 8:136081446-136081468 CCTCAGTCTCTGAGGATGCCTGG - Intergenic
1051085970 9:13349490-13349512 CCTCTGGCCCTCAGGATGCCTGG - Intergenic
1054847583 9:69812815-69812837 CATGAGTCTCTGAGGCTACCAGG - Intergenic
1056659754 9:88535141-88535163 CCTGAGGGCTTGAGGTTGCCTGG + Exonic
1057824251 9:98360055-98360077 TCTGAGCACCTGAGGATTCCAGG - Intronic
1060558285 9:124521463-124521485 CCTGGGTCCCTGAGGAAAACTGG + Exonic
1061471893 9:130833824-130833846 CCTGAGGTACTGAAGATACCCGG + Intronic
1062497135 9:136837278-136837300 CCTGAGGCCCTCAGGTGACAGGG - Intronic
1186221543 X:7354508-7354530 TCTGAGGCCCTGAGCATTCTTGG + Exonic
1186989827 X:15055496-15055518 CCCAAGGGCCTGAGGATACCAGG + Intergenic
1187329235 X:18320786-18320808 CCTGGGGCCCTGAGGAAAAGGGG - Intronic
1188440334 X:30209781-30209803 CCTGAGGTCCTGAGGAGAGCCGG + Intergenic
1190323387 X:49191565-49191587 CCTGAGGCCCGTAGGAATCCTGG + Exonic
1192177204 X:68893479-68893501 CCTGCAGGCCTGAGGACACCTGG + Intergenic
1200063051 X:153492080-153492102 CCTGAGGCCCTCAGGGATCCTGG - Intronic
1200072384 X:153535575-153535597 TCTGTGGCCCTGAGAGTACCTGG - Intronic