ID: 1018988099

View in Genome Browser
Species Human (GRCh38)
Location 6:168653162-168653184
Sequence CAAGAACTGATGGGCTGCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018988099 Original CRISPR CAAGAACTGATGGGCTGCCT GGG Exonic
903331850 1:22600624-22600646 CAAGAGTTGAGGGGCTGCCCAGG - Intronic
904004679 1:27357527-27357549 GAAGAGCTGCTGCGCTGCCTCGG - Exonic
904615773 1:31748729-31748751 CACAAACAGATGTGCTGCCTGGG + Intronic
905240167 1:36576205-36576227 CAGGAACCGATGCGCTGCCCAGG - Intergenic
905938094 1:41840711-41840733 CAGGATCTGATGGGCTCCGTGGG - Intronic
906640080 1:47436649-47436671 CAGGAACTGAGCGGATGCCTGGG - Exonic
909277851 1:73710784-73710806 CAAGAACTAATGGTCTGCACTGG + Intergenic
910179352 1:84464158-84464180 CAAGGACTGAGGGGCATCCTTGG - Intergenic
918066121 1:181103011-181103033 CAAGGACTCATGGCCTCCCTAGG - Intergenic
918200218 1:182259402-182259424 CATTAACTGCTGGGCTTCCTGGG + Intergenic
918847140 1:189631163-189631185 CAAAAAATGATGGTTTGCCTAGG - Intergenic
919867593 1:201793940-201793962 CAAGAACAGATGGTCAGCTTCGG - Intronic
922753058 1:228080023-228080045 GAAGGACAGATGGGCTGTCTGGG - Intergenic
923461573 1:234213880-234213902 CAAGAAGTGAATGGCAGCCTTGG + Intronic
924726246 1:246673876-246673898 CAACAACTGATGTGATACCTTGG + Intergenic
1063539831 10:6920814-6920836 CAAGAACTAATGGGACGTCTTGG + Intergenic
1069617098 10:69813283-69813305 CCAGAACTGATGGTGTGCATGGG - Intronic
1076538596 10:131199039-131199061 CAAGATCTCATGGGCACCCTGGG + Intronic
1077297576 11:1833241-1833263 CAGGAGCTGAGGGGCTGCCGAGG + Intronic
1077365191 11:2158749-2158771 CGAGAACCTAGGGGCTGCCTGGG - Intronic
1083194793 11:61079426-61079448 CAAGAACTGAGGGGCAGGGTGGG + Intergenic
1083315247 11:61810918-61810940 CAGGCAATGAAGGGCTGCCTTGG - Intronic
1085281907 11:75336437-75336459 CAAGCACTGGGTGGCTGCCTTGG - Intronic
1085464791 11:76716256-76716278 CAAGAGGTTATGGGCTCCCTCGG + Intergenic
1085608840 11:77928125-77928147 CAAGAAAGGATAGGATGCCTAGG - Intronic
1089668008 11:120032549-120032571 TAAGGACTGAGGGGCTGTCTGGG - Intergenic
1090357245 11:126148133-126148155 AAAGAAGTCCTGGGCTGCCTGGG - Intergenic
1090975466 11:131676385-131676407 AAAGAAGTGAAGGGCTGCGTTGG + Intronic
1091909811 12:4220467-4220489 CAGGAACAGAGGGGCTGCCAGGG + Intergenic
1096928178 12:55172872-55172894 CATAAACTGAGGGCCTGCCTGGG + Intergenic
1102635321 12:114318634-114318656 CCAGAACTGCTGGTCTACCTCGG - Intergenic
1103341217 12:120222194-120222216 CAAGAACTTATGGGATCACTGGG - Intronic
1104050907 12:125193083-125193105 CAAGAAAGGAAGGGCTGACTGGG + Intronic
1105840880 13:24252786-24252808 CCAGAATTGATGGGATGGCTGGG + Intronic
1106905768 13:34407529-34407551 CAAGATCAGAGGGTCTGCCTAGG - Intergenic
1108592765 13:51925571-51925593 CTGGAACTGAGGGGCTGTCTGGG - Intergenic
1111437902 13:88236480-88236502 GAAGAACTGATGTGACGCCTGGG - Intergenic
1111909757 13:94297757-94297779 CTAAAACTGATGGCTTGCCTTGG + Intronic
1113066246 13:106376274-106376296 AAAGCACTGATGTGCTGCTTAGG - Intergenic
1114398868 14:22391272-22391294 CAAGAGCAGATTGGCTGCCAAGG + Intergenic
1115252117 14:31359948-31359970 GATGAAATGATGTGCTGCCTAGG - Intronic
1118905972 14:70023411-70023433 CCTGAGCTGAAGGGCTGCCTGGG + Exonic
1119125271 14:72119691-72119713 AAAGATGTGATGGACTGCCTTGG + Intronic
1124369916 15:29098797-29098819 GAAGACCTGCTGGGCTACCTGGG + Intronic
1125639740 15:41220556-41220578 CTAGAAGTTGTGGGCTGCCTTGG - Intronic
1127723559 15:61725922-61725944 CCAGATGTGCTGGGCTGCCTTGG - Intergenic
1127732717 15:61815414-61815436 CCAGGACTGAAGGGCTTCCTAGG + Intergenic
1130414802 15:83682973-83682995 CAAGCTTTGATGGCCTGCCTGGG - Intronic
1130889818 15:88124289-88124311 CAAGAAAGGAAGGTCTGCCTGGG + Intronic
1131457750 15:92596662-92596684 CAAGAACTGATGGGGAGTCATGG - Intergenic
1132063147 15:98709269-98709291 CGGGAACTGAAGGGCTACCTGGG - Intronic
1132924641 16:2422679-2422701 CAAGCACTGATGGGGTGCTCTGG - Intergenic
1133898548 16:9951857-9951879 GAAGAACACATGGGCTGACTTGG - Intronic
1133948658 16:10371105-10371127 CAAGAACTGAAGACCAGCCTGGG - Intronic
1137404943 16:48182024-48182046 CAATAACAGCTGGGCTGACTGGG - Intronic
1137404982 16:48182364-48182386 CAATAACAGCTGGGCTGACTGGG + Intronic
1137693945 16:50448700-50448722 CCAGGACGGCTGGGCTGCCTGGG + Intergenic
1140344753 16:74202369-74202391 CAAGAATTGATGGAATTCCTAGG + Intergenic
1141135244 16:81460516-81460538 CCAGGACTGAGGGGCTTCCTGGG - Intronic
1142310973 16:89313364-89313386 CCAGAACCGCTGAGCTGCCTCGG - Intronic
1146688973 17:34860034-34860056 GGAGAACTGAGGGGCAGCCTTGG - Intergenic
1148444980 17:47732248-47732270 CATGCTCTGAAGGGCTGCCTCGG - Intergenic
1150434341 17:65142295-65142317 CCAGAACTGGAGGGCTTCCTAGG + Intronic
1150466215 17:65394950-65394972 CAAGACTTGAGGGGTTGCCTTGG - Intergenic
1151262835 17:72930186-72930208 CCAGAACTAATGAGCTGCCCTGG - Intronic
1152664169 17:81557807-81557829 CAAGAGCAGATGAGCTGCTTGGG + Exonic
1157308963 18:46537663-46537685 CAAGACCTGATGGGAAGCCATGG + Intronic
1157884501 18:51353403-51353425 CAAAAACTGATGGTCAGCCAAGG + Intergenic
1158427173 18:57351108-57351130 GAAGACCTGATGAGCTCCCTTGG - Exonic
1159058070 18:63486300-63486322 CAATAAATGGTGGGCTGCCCTGG - Intronic
1159966821 18:74603008-74603030 CATGATCTGCCGGGCTGCCTGGG - Intronic
1160785575 19:898925-898947 CAGGACCAGATGGGGTGCCTGGG + Intronic
1161576595 19:5057982-5058004 GAGGGACTGATGGGCTGCTTAGG + Intronic
1161737708 19:6001835-6001857 CAAGAACTGCCGGGCGGCCTTGG + Exonic
1164560340 19:29287751-29287773 CCAGAAGTGATGGGCTGTCTTGG + Intergenic
1165007824 19:32820870-32820892 ACAGAGTTGATGGGCTGCCTGGG + Intronic
1166282966 19:41807490-41807512 CAGGAAGTGATGGCCAGCCTGGG - Intronic
1167558452 19:50210427-50210449 CAGGAACGGCTGGGCCGCCTCGG - Exonic
1168452383 19:56476652-56476674 TAAGATGTGATGGGCTGCCCTGG - Intronic
925394487 2:3522982-3523004 CAGCAAGTGCTGGGCTGCCTTGG - Intergenic
928261085 2:29767438-29767460 CAGGGACTGATGGGTTTCCTGGG - Intronic
928700785 2:33896523-33896545 CCAGAACTGAGGGCCTGCTTGGG + Intergenic
932247537 2:70207986-70208008 CAAGAAATGATGGCCAGGCTCGG - Intronic
943205164 2:184885742-184885764 CAAGATCTGATGGGTTTACTGGG - Intronic
944929308 2:204500430-204500452 CAAGAAGTTGTGGGGTGCCTGGG + Intergenic
945924705 2:215791440-215791462 AAAGAAGTGATGGGCTGAATAGG - Intergenic
946467334 2:219923667-219923689 CAAGAACTGATCATCTGCTTAGG + Intergenic
947283027 2:228477488-228477510 CAAGAATTAATGGGCTATCTTGG + Intergenic
947840785 2:233206675-233206697 CAAGAACAGAAGGGCTGTCAGGG - Intronic
949044678 2:241866996-241867018 CCAGAACGGATGCACTGCCTGGG - Intergenic
1168841169 20:911072-911094 CAAGAATTTGTGGGCAGCCTGGG + Intronic
1168955692 20:1832759-1832781 CCAGAGCTGCCGGGCTGCCTGGG - Intergenic
1171400332 20:24868960-24868982 CAAGACCTGATGGGCCGTCAGGG - Intergenic
1172263550 20:33590774-33590796 CAAAAGCTGATGGGCTGACTGGG + Intronic
1172539615 20:35700814-35700836 CGAGAGCTGATGGGCGGCATTGG + Exonic
1175060349 20:56236492-56236514 CAAGATCTGATGGGCTTATTAGG + Intergenic
1179317442 21:40256563-40256585 AAAGAACTGATGTGCAGCTTGGG + Intronic
1180867542 22:19127986-19128008 CAAGCACTGAGGGTCTGCCCTGG - Intergenic
1182335326 22:29580272-29580294 CAAGGAGTGAGGGGCTGCCCAGG + Intronic
1184197381 22:42939085-42939107 TAAGAGCTGATGGGCTGCGCTGG - Intronic
950540411 3:13609127-13609149 CAGTCACTGTTGGGCTGCCTGGG - Intronic
953295597 3:41712363-41712385 CATGAGCTGCTGGCCTGCCTTGG - Intronic
954289207 3:49640356-49640378 CGAGAGCTCATGGGCTGCTTTGG + Intronic
955373624 3:58375003-58375025 AAAGAACTGATGGGATGTCTGGG + Intronic
956334586 3:68148918-68148940 AAAGAAGTGATAAGCTGCCTTGG + Intronic
956857993 3:73294650-73294672 GAAGAACGGATGGGCTGCCGAGG - Intergenic
957615174 3:82517579-82517601 CCAGAACTGAGGGGTTTCCTGGG + Intergenic
957668857 3:83274332-83274354 CAAGATCTGATGGGCTAATTGGG - Intergenic
957729393 3:84113286-84113308 CCAGAACTGATGGGCTTCCTTGG + Intergenic
965442970 3:168739000-168739022 CAAGACCAGATGCGCTGGCTGGG - Intergenic
967378106 3:188828077-188828099 CAAGAACTAAAGTGGTGCCTAGG - Intronic
968695525 4:2024163-2024185 AAAGAACAGGTGGGCTCCCTGGG + Intronic
969186679 4:5479609-5479631 CCAGATGGGATGGGCTGCCTTGG + Intronic
969224326 4:5784978-5785000 AAAGGACTGGTGGGCTGTCTTGG - Intronic
972529547 4:39949319-39949341 AAAGAACTGATGGTATGACTGGG + Intronic
975956995 4:79852975-79852997 TAAGAACTGATGAGCTGACTAGG + Intergenic
977452520 4:97217223-97217245 CATTAACTGATGGTCTTCCTTGG - Intronic
978437036 4:108696693-108696715 CAACAACTGTTGGGATGTCTTGG + Intergenic
979283449 4:118894346-118894368 CCAGAATGGATGGGCTGCCTGGG + Intronic
979923132 4:126525796-126525818 CAAGAACTGATGGGTTTCTCAGG - Intergenic
987808526 5:22802669-22802691 CCAGAACTGATGGTATTCCTGGG - Intronic
990806156 5:59665109-59665131 CATGAACTGATTGTCTTCCTAGG + Intronic
991992098 5:72349971-72349993 CTAGAAATGATGTGCTCCCTGGG - Intronic
994369732 5:98954536-98954558 CAAGATCTGCAGGGCTGCCCAGG + Intergenic
997648756 5:135499285-135499307 CCAGAACTGAGGGGATTCCTGGG + Intergenic
997758489 5:136422466-136422488 AAAGAACTGATGTGCTGAGTTGG + Intergenic
1006163852 6:32053292-32053314 CAAGAGCAGAGGGGCTTCCTGGG + Intronic
1006452180 6:34111669-34111691 CAAGAGCTGATGGGCTGGGTGGG + Intronic
1006791792 6:36706260-36706282 CAAGGACTAATGGGGTACCTGGG + Intronic
1011115127 6:83881406-83881428 CAAGGAGTGGTGGGCTGCTTGGG - Intronic
1012806703 6:103903752-103903774 CAGGAAGGAATGGGCTGCCTAGG + Intergenic
1013305518 6:108843855-108843877 GATGAACTGATTCGCTGCCTGGG - Intergenic
1018012683 6:159686014-159686036 CAGGAAGAGCTGGGCTGCCTTGG - Intronic
1018398056 6:163395959-163395981 CAGGGTCTGATGGGCTGCTTGGG + Intergenic
1018725462 6:166609348-166609370 AAAGATCTGTTGGGCTGTCTGGG + Intronic
1018988099 6:168653162-168653184 CAAGAACTGATGGGCTGCCTGGG + Exonic
1019374322 7:681087-681109 CAAGATCTGATGGGTTTCCAAGG + Intronic
1019375160 7:686885-686907 CTGGAACTTATGGCCTGCCTAGG + Intronic
1023013281 7:35941927-35941949 CAAGAACTCCTTGGCTGCCTGGG + Intergenic
1023438779 7:40165621-40165643 AAAGAACTGATGGGCTGGGTGGG - Intronic
1024077859 7:45831909-45831931 CAAGAACTCCTTGGCTGCCTGGG - Intergenic
1024294946 7:47834175-47834197 CAAGACCTGTTGTGCTGGCTGGG - Intronic
1025126557 7:56349514-56349536 CAAGAACTCCTTGGCTGCGTGGG + Intergenic
1025844063 7:65179685-65179707 CAAGAAAGGATAGGATGCCTAGG + Intergenic
1025894391 7:65685994-65686016 CAAGAAAGGATAGGATGCCTAGG + Intergenic
1028758184 7:94462550-94462572 CATGAACTAATAGGCTGGCTAGG + Intergenic
1029136598 7:98377074-98377096 CAAGATCTGTAGGGCAGCCTGGG - Intronic
1029803198 7:102971687-102971709 CAAGAATTGAAGGCCAGCCTGGG + Intronic
1031549907 7:123096600-123096622 CAAGAACAGATGGGATGACAGGG + Intergenic
1032608393 7:133384069-133384091 CAGGAACTGATGAGCAGCCAGGG + Intronic
1036690385 8:10941231-10941253 CAAGGGCTGAAGGGTTGCCTGGG - Intronic
1037581778 8:20249709-20249731 TGAGATCTGAGGGGCTGCCTGGG - Exonic
1037834914 8:22210023-22210045 CAGGCCCTGGTGGGCTGCCTTGG - Intronic
1038157330 8:25002021-25002043 CAAAAACTGGTGCGCAGCCTCGG - Intergenic
1041182320 8:55261521-55261543 CAAAAAATGATGGGTTGGCTTGG - Intronic
1042756830 8:72223413-72223435 AAATAAAGGATGGGCTGCCTTGG + Intergenic
1042910369 8:73820032-73820054 CCAAAACTCCTGGGCTGCCTTGG + Intronic
1045502084 8:102751368-102751390 CAAGAACTAATGGGCCGGCCAGG + Intergenic
1047925900 8:129682395-129682417 CAAGAGATGATGGGCTGCCGTGG - Intergenic
1055890996 9:81123075-81123097 CAAGAGCAGGTGGGCTGCCTGGG + Intergenic
1056127035 9:83544336-83544358 CAAGCCCTGATGGGGTGCTTAGG - Intergenic
1059427775 9:114231819-114231841 CAGGGACTGATGGGCAGCGTGGG + Exonic
1062711793 9:137978780-137978802 CTCAAACTGATGGGCAGCCTGGG - Intronic
1203561322 Un_KI270744v1:60538-60560 CAAGAACTCAGGGGCCGCCGGGG + Intergenic
1189362468 X:40363313-40363335 CCAGGACTGATGGGTTTCCTGGG + Intergenic
1190723458 X:53171077-53171099 CAGGAACTGCTGAACTGCCTGGG - Intergenic
1193076928 X:77364550-77364572 CAGGAAGGAATGGGCTGCCTGGG - Intergenic
1195217064 X:102712748-102712770 CAAGGGCTGAGGGGCTGGCTCGG + Intronic
1198042991 X:132872994-132873016 CAGGAAGTGATGGGCTGGGTTGG - Intronic
1199885464 X:152016917-152016939 CTAGAACTGATGGGGAACCTTGG + Intergenic
1200141479 X:153904892-153904914 CCGGGACTCATGGGCTGCCTGGG + Intronic