ID: 1018989553

View in Genome Browser
Species Human (GRCh38)
Location 6:168663127-168663149
Sequence AACCTGAGCCCACCAGTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018989549_1018989553 23 Left 1018989549 6:168663081-168663103 CCTTGGGAGCTGTCAGGAAATAG 0: 1
1: 0
2: 4
3: 21
4: 210
Right 1018989553 6:168663127-168663149 AACCTGAGCCCACCAGTGAGTGG 0: 1
1: 0
2: 0
3: 11
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018989553 Original CRISPR AACCTGAGCCCACCAGTGAG TGG Intronic
901149050 1:7088143-7088165 AACCTGAGCACAACAGAGATGGG + Intronic
901718696 1:11177472-11177494 CACTTGAGCCCACGAGTGTGAGG + Intronic
902787020 1:18739293-18739315 CACCTGAGCCCACCCATGCGTGG + Intronic
903035914 1:20492465-20492487 ATCCTGGGCTCAGCAGTGAGGGG - Intergenic
903663566 1:24993409-24993431 AACCTTAGACCAGCAGGGAGCGG + Intergenic
903688114 1:25147419-25147441 GACCTGAGCTCAGTAGTGAGAGG - Intergenic
904526039 1:31134730-31134752 CACTTGAGCCCACAAGTTAGAGG - Intergenic
906528804 1:46511690-46511712 ACCCTAAGCCCAGCAGGGAGGGG + Intronic
907195521 1:52683420-52683442 GACCTGAGCCCAGGAGTTAGAGG + Intergenic
907296137 1:53456099-53456121 AACCTGAGCCCAGAAGGCAGAGG + Intergenic
908782550 1:67704505-67704527 AACATGAGCCCAGCTGAGAGAGG - Exonic
915230916 1:154444817-154444839 CACCTGAGCCCAGCAGTTGGAGG + Intronic
917594845 1:176518682-176518704 AACATGAGCCCACATGTGTGTGG + Intronic
919604604 1:199666512-199666534 ATCCTGAGCCCACTATTGATTGG - Intergenic
920309945 1:205043127-205043149 GACCAGAGCCAGCCAGTGAGCGG + Intergenic
920866427 1:209757406-209757428 AAGCTGAGCCAAACAGGGAGGGG + Intronic
921458129 1:215396084-215396106 AACTTGAGCCCAGCAGTTTGAGG + Intergenic
1065768974 10:29059079-29059101 CACCTGAGCCCAGGAGTGTGAGG + Intergenic
1067177168 10:43958246-43958268 AGTCTGACCCCATCAGTGAGAGG - Intergenic
1071517467 10:86308243-86308265 AAACTGAGCCCACCTCTGAGTGG + Intronic
1075179269 10:120195776-120195798 AACCTGGACACACCATTGAGGGG - Intergenic
1080035654 11:27707565-27707587 AACCTTAGTCAGCCAGTGAGAGG + Intronic
1081417494 11:42833568-42833590 CACTTGAGCCCAGAAGTGAGAGG - Intergenic
1081508736 11:43745924-43745946 CACTTGAGCCCAAGAGTGAGAGG + Intronic
1082032196 11:47612985-47613007 AACCTGAGCCCAGGAGTTTGAGG - Intergenic
1082916172 11:58439941-58439963 AACCAAAGTCCACCAGGGAGAGG + Exonic
1083235190 11:61346534-61346556 CACCTCAGCACAGCAGTGAGAGG - Exonic
1083595700 11:63917453-63917475 AACCCGAGCCCACTGGTGTGTGG - Intergenic
1085018114 11:73188534-73188556 TAACTGACCCCAACAGTGAGTGG - Intergenic
1086464356 11:87037988-87038010 AGCCTGAGCCCTGCAGGGAGGGG - Exonic
1092732384 12:11547095-11547117 AACCTAACCCTGCCAGTGAGAGG + Intergenic
1093761695 12:22918377-22918399 AGCCTGAGCCCCCCAGGAAGAGG + Intergenic
1094552943 12:31470030-31470052 CACCTGAGCCCAGGAGTTAGAGG - Intronic
1095655945 12:44668906-44668928 AACCTGAGCACACCACCCAGAGG + Intronic
1096789558 12:54036309-54036331 ACCCTCACCCCACCAGTGTGGGG - Intronic
1103265373 12:119625451-119625473 CACCTGAGCCCACGAGTTTGAGG - Intronic
1103385970 12:120533057-120533079 CACCTGAGCCCAGCAGTTGGAGG - Intronic
1103610946 12:122124018-122124040 AACCTGACCAGAGCAGTGAGGGG - Intronic
1103694630 12:122804799-122804821 CACCTGAGCCCAGGAGTTAGAGG - Intronic
1105276820 13:18937505-18937527 CACTTGAGCCCAGCAGTTAGAGG - Intergenic
1105435905 13:20378174-20378196 AAACAAAGCCCAACAGTGAGTGG - Intergenic
1107354611 13:39553626-39553648 CACTTGAGCCCAGCAGTGTGAGG + Intronic
1107880835 13:44830624-44830646 AAGCAGAGCCCACCAGTCAGAGG - Intergenic
1110941776 13:81359876-81359898 AACCTGAGTCCATCAGTGGTTGG - Intergenic
1115329322 14:32178023-32178045 AATCTGGGTGCACCAGTGAGTGG + Intergenic
1115589001 14:34844683-34844705 AACCTGAGCCCAGAAGTTCGAGG + Intronic
1116185330 14:41593193-41593215 CACCTGGGCCCATCAGAGAGAGG + Intergenic
1118012506 14:61624363-61624385 CACCTGAGCCCACGAGGCAGAGG - Intronic
1124111888 15:26798063-26798085 CACCTGAGCCCAGGAGTCAGAGG + Intronic
1126120919 15:45250799-45250821 CACCTGAGCCCAGAAGTTAGAGG + Intergenic
1127288866 15:57553131-57553153 ATCCTGAGCACAGCAGTCAGAGG + Intergenic
1127842776 15:62845346-62845368 AGCCTGAGCCGACCAGGAAGGGG + Intergenic
1130246771 15:82258465-82258487 CACCTGAGCCCAACAGGGCGAGG + Intronic
1131892072 15:96983950-96983972 GACCCGAGCCCCCCAGTGACTGG + Intergenic
1133539477 16:6735286-6735308 AACATGAACCCACTGGTGAGTGG - Intronic
1134161336 16:11892257-11892279 CACCTGAGCCCAGGAGTGTGAGG + Intronic
1134215521 16:12314067-12314089 CACCTGAGCCCAACAGTTGGAGG - Intronic
1135699249 16:24617207-24617229 CACCTGAGCCCAGGAGTGGGAGG - Intergenic
1137690850 16:50426337-50426359 CACTTGAGCCCAGCAGTTAGAGG - Intergenic
1137691036 16:50427893-50427915 CACTTGAGCCCAGCAGTTAGAGG + Intergenic
1139799134 16:69507128-69507150 CACCTGAGCCCAGGAGTTAGGGG - Intergenic
1141135049 16:81459654-81459676 GACCGGAGGCCACCAGTCAGAGG - Intronic
1141381823 16:83583831-83583853 CACTTGAGCCCACGAGGGAGAGG + Intronic
1141510553 16:84509341-84509363 ACCAGGAGCCCAGCAGTGAGGGG + Intronic
1141640838 16:85340264-85340286 CACTTGAGCCCACCAGTTCGAGG + Intergenic
1144348592 17:14372534-14372556 ATCCTGAGCCCAGCAGTTGGAGG - Intergenic
1145037916 17:19554028-19554050 AGCCTGAGACCACCAGAGACAGG + Intronic
1145059039 17:19720826-19720848 GAGCTGAGCCCTCAAGTGAGGGG - Intergenic
1146952888 17:36918945-36918967 AACTCATGCCCACCAGTGAGGGG + Intergenic
1146960235 17:36968703-36968725 AACCTGAGCCCAGGAGTCTGAGG - Intronic
1147863876 17:43540623-43540645 TACCTGAGCCCAGGAGTTAGAGG - Intronic
1151375947 17:73689230-73689252 AACCAGATCCCAGCAGGGAGGGG - Intergenic
1151396710 17:73827626-73827648 CACCTGGCCCCACCAGTGAAGGG - Intergenic
1151555365 17:74843791-74843813 AACCTGGGCACACCTGTGGGGGG + Intronic
1151729125 17:75900635-75900657 CACCTGAGCCCAGGAGTTAGCGG + Intronic
1153322130 18:3783996-3784018 AAAATGAGCCCACCAGCCAGGGG - Intronic
1156408291 18:36803981-36804003 CACCTGAGCCCACGAGTTTGAGG - Intronic
1156786491 18:40921500-40921522 AGCCTGAGTCCACCAGTGGTGGG + Intergenic
1157099660 18:44717723-44717745 AGGCTTAGTCCACCAGTGAGAGG - Intronic
1160201780 18:76802045-76802067 AACCTGGGCCCACGTGGGAGTGG + Intronic
1163015586 19:14452009-14452031 AAGCCGAGAACACCAGTGAGTGG + Exonic
1165116733 19:33533322-33533344 CACCTGAGCCCCGAAGTGAGGGG + Intergenic
1166088220 19:40490956-40490978 CACTTGAGCCCAGCAGTGTGAGG + Intronic
1166366869 19:42282243-42282265 AACCTGAGCCCAAAAGGGAAGGG - Intronic
1167269152 19:48498295-48498317 AGCCTGAGCCTCCCAGTGAACGG - Exonic
925825643 2:7846183-7846205 ACCCTGAGCCCATCAGAGAGAGG + Intergenic
925964683 2:9052966-9052988 AAACTTACCCCACCAGTGGGAGG - Intergenic
929560746 2:42954912-42954934 AAACTGAGTCCACCAGAAAGTGG + Intergenic
929756171 2:44767622-44767644 GGCCTGACTCCACCAGTGAGAGG - Intronic
930029206 2:47048092-47048114 AACATGAGACCAGCAGTGTGGGG - Intronic
930162902 2:48176480-48176502 ATCCTGAGTACACCAGTGTGAGG + Intergenic
930599223 2:53424523-53424545 CACCTGAGCACATCAGTCAGTGG - Intergenic
931158658 2:59664372-59664394 GCCCTGAGCCCACCAATGAGGGG - Intergenic
931641739 2:64386587-64386609 GCCCTGAGGCCATCAGTGAGTGG + Intergenic
931740486 2:65238082-65238104 CACTTGAGCCCAGCAGTTAGAGG + Intronic
934047824 2:88186695-88186717 CACCTCAGCCCACCACTCAGCGG - Intergenic
937127474 2:119483587-119483609 AAGCACAGGCCACCAGTGAGTGG - Intronic
938204302 2:129404275-129404297 AATCTGAGTCCAAAAGTGAGAGG - Intergenic
938473961 2:131590629-131590651 AACATGAGGCCATCAGCGAGGGG - Intergenic
939745382 2:145960653-145960675 CACAGGAGCCCACCACTGAGGGG + Intergenic
940041718 2:149368447-149368469 CACTTGAGCCCAGCAGTCAGAGG + Intronic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
943298908 2:186173020-186173042 AACCTGAGCCCAGGAGTTTGAGG + Intergenic
945229741 2:207573647-207573669 CACTTGAGCCCACCAGTTGGAGG + Intronic
946827618 2:223695033-223695055 TACCTGAGCCCACGAGTTTGAGG + Intergenic
948108847 2:235438062-235438084 AGCCTGAGCCCACCAGTTCAAGG - Intergenic
948561379 2:238855893-238855915 AACATGAGCCCACGAAGGAGAGG - Intronic
1169242212 20:3993248-3993270 AAACTGAAACCACTAGTGAGTGG + Intronic
1169686924 20:8285766-8285788 CACCTGTACCCACCAGTGCGGGG + Intronic
1170966531 20:21077334-21077356 AACTTGAGCCCATGAGTTAGAGG + Intergenic
1171055776 20:21904730-21904752 AAGCTGAGCAGGCCAGTGAGGGG + Intergenic
1171185968 20:23124488-23124510 AGCCTGGGCCCAGGAGTGAGAGG + Intergenic
1173869887 20:46334710-46334732 AGCCTCAGCCCAGCACTGAGGGG + Intergenic
1173996206 20:47340393-47340415 CACCTGAGCCCAGGAGTTAGAGG + Intronic
1175052915 20:56171469-56171491 GATCTCAGCCCACCAGTGTGAGG - Intergenic
1175581650 20:60104478-60104500 AAAGTGACCCCACCAGTGAGGGG - Intergenic
1178996276 21:37403547-37403569 CACTTGAGCCCAGCAGTGTGAGG - Intronic
1181616153 22:24055891-24055913 AAGTTCAGCCGACCAGTGAGGGG + Intronic
1182094787 22:27618714-27618736 AACTTGAGCCCACCAGGTCGAGG + Intergenic
1182300074 22:29332192-29332214 TACCTGGGCCCACCAGTGCCTGG - Intronic
1182301712 22:29340726-29340748 GACCTCGGCCCCCCAGTGAGCGG - Exonic
1182371166 22:29812093-29812115 AAGCTGAGGCGACCAGGGAGGGG + Intronic
1182483135 22:30622665-30622687 AACATCAGCCCCCCAGAGAGGGG + Intronic
1182628178 22:31663652-31663674 CACCTCAGCCTCCCAGTGAGTGG - Intergenic
1183101026 22:35584182-35584204 TACCTGAGCCCAAGAGTCAGAGG + Intergenic
1183463329 22:37966396-37966418 CACCTGAGGCCAGCAGTCAGGGG - Intronic
1184089548 22:42285038-42285060 AGCCTCTGCCCTCCAGTGAGAGG + Intronic
1184358701 22:44000090-44000112 AACCTGAGGAAAGCAGTGAGTGG - Intronic
950205468 3:11076868-11076890 GCCCTGCGCCCAGCAGTGAGAGG + Intergenic
952079151 3:29736617-29736639 ACCCAGAGCCTACCAATGAGTGG - Intronic
952998613 3:38909297-38909319 CAACTGAGCCCACCAGTGCTGGG - Intronic
953958221 3:47247516-47247538 AACCTGAGCCCACAGGGGAGTGG + Intronic
955283443 3:57616238-57616260 CACTTGAGCCCAGCAGAGAGAGG + Intergenic
959703689 3:109321090-109321112 CACTTGAGCCCAGGAGTGAGAGG - Intergenic
960545633 3:118911546-118911568 AACTTGAGCCCAGGAGTGTGAGG + Intronic
963427594 3:145152285-145152307 GGCCTGAGACCAACAGTGAGTGG + Intergenic
963588413 3:147225199-147225221 AACCTGACACCACCAGGGACTGG - Intergenic
963893731 3:150663556-150663578 AACTTGAGCCCACCATTGGCGGG - Intronic
964848520 3:161069275-161069297 GACCTAAGACCACCAGGGAGGGG - Exonic
968566180 4:1314555-1314577 CACCAGAGCCCACCAGTGGGTGG + Intronic
968940407 4:3634660-3634682 GACCTGAGCTGACCAGGGAGGGG + Intergenic
970357876 4:15275596-15275618 AACCTATGCCCTCCAGTGACAGG - Intergenic
980530743 4:134049980-134050002 AGTCTGATCCCACCAGTGAAAGG - Intergenic
988934929 5:36072009-36072031 ACCCTGAGCCCACCAGTGGCCGG - Intergenic
991549188 5:67817869-67817891 ATCCTGGGCACACCGGTGAGAGG - Intergenic
994402232 5:99295892-99295914 CACCTGAGCCCAACAGTATGGGG - Intergenic
995881910 5:116852732-116852754 AATCTGTGCACACCAGGGAGAGG + Intergenic
996444261 5:123526119-123526141 CACCTGAGCCCAGCAGTTTGAGG - Intronic
996883958 5:128333940-128333962 AAGCTGACCCCTCCAGTAAGGGG - Intronic
998011007 5:138695567-138695589 AACCTGAGCCCAGGAGTTCGAGG + Intronic
998536767 5:142940156-142940178 AACCTCAGCTCACCAGTCTGCGG + Intronic
1001637129 5:173218466-173218488 CACCTGAGCCCAGGAGTCAGAGG - Intergenic
1002378678 5:178808509-178808531 CACTTGAGCCCACCAGTTTGAGG + Intergenic
1006206157 6:32344937-32344959 CACTTGAGCCCAGTAGTGAGAGG - Intronic
1006305843 6:33218057-33218079 AACTGGAGCACACGAGTGAGGGG - Intergenic
1006511477 6:34523863-34523885 TTCCTGAGCCCACCACTGTGTGG + Intronic
1007588795 6:43008954-43008976 AAACTGTGCCCACCAGGGTGGGG + Intronic
1008938713 6:57021426-57021448 AACCTGAGCTCAGGACTGAGTGG - Intronic
1010197997 6:73258967-73258989 AACGGGAGCCCACTGGTGAGAGG + Intronic
1011967946 6:93183351-93183373 AGCAGGAGCCCACCACTGAGGGG + Intergenic
1014213963 6:118735473-118735495 AGCCTCATCCCACCAGGGAGAGG - Intergenic
1014359453 6:120458807-120458829 AACTTGAGCCCAGAAGTTAGAGG - Intergenic
1015029655 6:128579795-128579817 CACCTGAGCCCAGGAGTTAGAGG - Intergenic
1015718463 6:136216026-136216048 TACCTGATCCCAGGAGTGAGGGG - Intergenic
1015800694 6:137059524-137059546 CACCTGAGCCCAGGAGTCAGAGG + Intergenic
1016435012 6:144027138-144027160 CACCTGAGCCCACGAGTTTGAGG + Intronic
1018612023 6:165655828-165655850 GAGCTGAGCCCACCAGGCAGTGG - Intronic
1018989553 6:168663127-168663149 AACCTGAGCCCACCAGTGAGTGG + Intronic
1020207915 7:6133596-6133618 CACCTGAGCCCAGCAGTTGGAGG - Intronic
1020690096 7:11343714-11343736 AGCCAGTCCCCACCAGTGAGTGG - Intergenic
1026259125 7:68738795-68738817 GACCAGAGCCAACCAGAGAGGGG + Intergenic
1026357585 7:69572585-69572607 AACTTGAGCCCAAAAGTTAGAGG + Intergenic
1029530562 7:101122454-101122476 ACCCAGGGCCCACCAGTGGGTGG + Intergenic
1029630210 7:101745539-101745561 CACTTGAGCCCAGCAGTGTGAGG - Intergenic
1034036805 7:147833525-147833547 AAGCTGAGGCCAGCAGTGACTGG - Intronic
1036216386 8:6883241-6883263 ACCCTGGACCCTCCAGTGAGGGG - Intergenic
1037485252 8:19340687-19340709 AACCTGAGCCCAGGAGTTGGAGG - Intronic
1037700152 8:21266660-21266682 GGCCTGAGACCACCAGGGAGAGG + Intergenic
1042445326 8:68877711-68877733 CACTTGAGCCCAGGAGTGAGAGG + Intergenic
1042510592 8:69607446-69607468 AACCTGAGCCCAGGAGGGCGAGG - Intronic
1042918960 8:73902790-73902812 CACCTGAGCCCAACAATCAGAGG + Intergenic
1045007613 8:97929891-97929913 TACATGATGCCACCAGTGAGGGG - Intronic
1046396460 8:113646789-113646811 AACTTGATCTCAACAGTGAGGGG + Intergenic
1046748010 8:117896853-117896875 AACCTGAACCCTTCATTGAGGGG - Intronic
1048245350 8:132791222-132791244 AAGCTAAGCCCATCAGTGATAGG + Intronic
1048325115 8:133433061-133433083 AACCTGAGCTGACAGGTGAGAGG + Intergenic
1050354736 9:4771840-4771862 AACTTGAGCCCAGGAGTTAGAGG - Intergenic
1053270497 9:36746203-36746225 GACCTGAGCCTACCAGTGTCCGG - Intergenic
1056740961 9:89255165-89255187 ACCCTGGGCCCTACAGTGAGAGG + Intergenic
1057135443 9:92684349-92684371 AACTTGAGCCCAAGAGTTAGAGG + Intergenic
1057275900 9:93675834-93675856 AACCTGAGCCCACCAGGTGGGGG - Intronic
1057570882 9:96203534-96203556 AACCTGGACCCACCGGTGTGTGG + Intergenic
1060972731 9:127748103-127748125 AAGCTGAGGGCACTAGTGAGGGG - Intronic
1187298011 X:18021405-18021427 CACTTGAGCCCAACAGTGAGAGG + Intergenic
1188137694 X:26509974-26509996 TACCTGAGCCCAGCAGTTTGAGG - Intergenic
1191718397 X:64208693-64208715 AGCCAAAGCCCATCAGTGAGAGG + Intergenic
1192457543 X:71289683-71289705 CACTTGAGCCCACGAGTTAGAGG - Intronic
1192921606 X:75713067-75713089 AACCTGTCCCCACCTGTGGGTGG - Intergenic
1197451418 X:126623367-126623389 AACTTGAGCCCAGGAGTTAGAGG - Intergenic
1198399638 X:136256517-136256539 AGCCTGAGCTCACCAGGGAGGGG + Intergenic
1199169792 X:144722178-144722200 ATCCTGAGCCCACCAGTTTAAGG - Intergenic
1200913106 Y:8548378-8548400 AACCTCATCTTACCAGTGAGAGG + Intergenic