ID: 1018990874

View in Genome Browser
Species Human (GRCh38)
Location 6:168672772-168672794
Sequence ATGTGTTTTCAGATGGAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 543
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 510}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018990866_1018990874 20 Left 1018990866 6:168672729-168672751 CCGCCTCCCAGGTTCAAAGGGTT 0: 1
1: 97
2: 2998
3: 37344
4: 78628
Right 1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 510
1018990867_1018990874 17 Left 1018990867 6:168672732-168672754 CCTCCCAGGTTCAAAGGGTTCTC 0: 3
1: 127
2: 4289
3: 57174
4: 120205
Right 1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 510
1018990870_1018990874 -5 Left 1018990870 6:168672754-168672776 CCTGCCTCAGCCTCTTAAATGTG 0: 1
1: 6
2: 59
3: 541
4: 4669
Right 1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 510
1018990868_1018990874 14 Left 1018990868 6:168672735-168672757 CCCAGGTTCAAAGGGTTCTCCTG 0: 4
1: 117
2: 4187
3: 58932
4: 164856
Right 1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 510
1018990871_1018990874 -9 Left 1018990871 6:168672758-168672780 CCTCAGCCTCTTAAATGTGTTTT 0: 1
1: 0
2: 6
3: 48
4: 408
Right 1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 510
1018990869_1018990874 13 Left 1018990869 6:168672736-168672758 CCAGGTTCAAAGGGTTCTCCTGC 0: 4
1: 200
2: 7086
3: 91169
4: 126936
Right 1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG 0: 1
1: 0
2: 1
3: 31
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018990874 Original CRISPR ATGTGTTTTCAGATGGAGTG AGG Intronic
901719164 1:11181511-11181533 ATTTATTTTGAGATGGAGTCTGG - Intronic
902227366 1:15005103-15005125 ATGTGTTTTGGGATGAAGTTCGG - Intronic
902424735 1:16310960-16310982 GTTTGTTTTGAGATGGAGTCCGG - Intronic
902654614 1:17858954-17858976 CTGAGTCTGCAGATGGAGTGAGG - Intergenic
903135397 1:21306338-21306360 TTTTTTTTTCAGATGGAGTTTGG + Intronic
903205242 1:21777100-21777122 TTTTTTTTTCAGATGGAGTCTGG - Intronic
903428738 1:23275061-23275083 CTTTGTTTTGAGATGGAGTCTGG - Intergenic
903955864 1:27025156-27025178 ATTTATTTTGAGATGGAGTCTGG + Intergenic
904210790 1:28885774-28885796 AGATGTTTTCTGATGGAGGGAGG - Intergenic
904241040 1:29145566-29145588 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
904787118 1:32991541-32991563 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
904799116 1:33080687-33080709 ATGCGTTTTGAGTTGGAGTCGGG + Intronic
904941811 1:34168928-34168950 ATGACTTTTCAGATGGAGGGAGG + Intronic
904963288 1:34351501-34351523 CTGTGTTTTCTGTTGGAATGGGG + Intergenic
905568073 1:38981815-38981837 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
905719327 1:40183309-40183331 ATGTGTTTTCTAATAGAGAGGGG - Intronic
905816762 1:40957322-40957344 ATTTTTTTTGAGATGGAGTCTGG + Intergenic
906279682 1:44544568-44544590 CTGTGTTTTAAGATTGACTGAGG + Intronic
906899662 1:49820335-49820357 GTGTGTTTTCAGAAGGACTTTGG - Intronic
907026870 1:51128894-51128916 TTTTGTTTTGAGATGGAGTCTGG + Intronic
907837400 1:58123355-58123377 AGATGCTTTCAGATGGAGTAAGG - Intronic
908265962 1:62379558-62379580 ATTTATTTTGAGATGGAGTTTGG - Intergenic
908991435 1:70095986-70096008 TTGTTTTTTGAGATGGAGTCTGG + Intronic
909480142 1:76121702-76121724 TTGTTTTTTGAGATGGAGTCTGG - Intronic
909608314 1:77528779-77528801 AGGGGTTCTCAGCTGGAGTGGGG - Intronic
909900926 1:81134031-81134053 ATGTATTTTCAGGGAGAGTGGGG + Intergenic
910156122 1:84222304-84222326 GTGTGTTTACAGGTGAAGTGAGG + Intronic
910252405 1:85211579-85211601 TTTTGTTTTCAGACGGAGTCTGG + Intergenic
910832890 1:91478257-91478279 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
911701193 1:100953593-100953615 CGCTGCTTTCAGATGGAGTGGGG + Intronic
912340375 1:108908706-108908728 TTGTGTTTTGAGATGGAGTCTGG - Intronic
912989259 1:114467912-114467934 ATATATTTTCAGATAGAGAGGGG + Intronic
913521706 1:119650756-119650778 CTGTCTTTTCAACTGGAGTGTGG - Intergenic
913698951 1:121355758-121355780 ATGATTTTTCAGTAGGAGTGGGG + Intronic
914138594 1:144924287-144924309 ATGATTTTTCAGTAGGAGTGGGG - Intronic
915689831 1:157677868-157677890 GTTTTTTATCAGATGGAGTGAGG + Exonic
916996951 1:170311283-170311305 ATGTGTTTTTAGATGGTGTTTGG + Intergenic
917814763 1:178696672-178696694 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
918226750 1:182490925-182490947 TTTTTTTTTGAGATGGAGTGTGG + Intronic
918307034 1:183256395-183256417 ATTTTTTTTGAGATGGAGTCTGG - Intronic
918745038 1:188187895-188187917 ATGTGTGTCCAGATGGACTCAGG + Intergenic
919366911 1:196673296-196673318 TTTTGTTTTGAGATGGAGTCTGG + Intronic
920122522 1:203669445-203669467 CTGTTTTTTGAGATGGAGTCTGG + Intronic
920486363 1:206374465-206374487 ATGATTTTTCAGTAGGAGTGGGG + Intronic
921538928 1:216388212-216388234 ATGTGTCTTCAGATTGAGAAGGG + Intronic
921726745 1:218532883-218532905 ATGTGTGTTAAGATTGAGTAAGG + Intergenic
921868010 1:220107277-220107299 ATATGTTTTAAAATGGAGTTTGG + Intronic
922971242 1:229741498-229741520 ATATGTTTGCAGATGAAATGAGG + Intergenic
923474412 1:234319393-234319415 ATGTGTTTTTAGATGGAAACTGG - Intronic
923572852 1:235131495-235131517 TTGTTTTTTGAGATGGAGTTTGG - Exonic
923700183 1:236292778-236292800 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
924227633 1:241935011-241935033 ATGTGATTTCAGCTGCAGAGTGG - Intergenic
1063130485 10:3173141-3173163 GTGTGTATGCAGATGAAGTGGGG + Intergenic
1063192825 10:3713810-3713832 ATGTGTCTTCAGATTGAATAAGG + Intergenic
1064202572 10:13297463-13297485 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1064455913 10:15487392-15487414 TTTTGTTTTGAGATGGAGTCAGG - Intergenic
1064898657 10:20269510-20269532 ATACCTTTTCAGATGGAATGGGG + Intronic
1065095519 10:22277048-22277070 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1065241625 10:23711073-23711095 ATGTGCATACAGAAGGAGTGAGG + Intronic
1065348817 10:24776498-24776520 ATGTGTTTTTAGAAAGAATGTGG - Intergenic
1066676562 10:37893615-37893637 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
1068049404 10:51930211-51930233 ATGGTGTTTGAGATGGAGTGGGG + Intronic
1068209940 10:53908393-53908415 ATGTGCATGCAGATGGATTGAGG - Intronic
1068294107 10:55045012-55045034 ATGTGTTTACAGAATGAGTATGG - Intronic
1068610762 10:59057480-59057502 ATGCTTTTTCAGATGGAGATTGG + Intergenic
1070440572 10:76438833-76438855 ATGTGTATTCAGATGGCTTTTGG + Intronic
1070462902 10:76687788-76687810 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1073526352 10:104186028-104186050 ATCTGTCTTCACATGGATTGTGG - Exonic
1073749113 10:106504001-106504023 ATGTGATTTCAGATGGCTTGAGG - Intergenic
1074800534 10:116996523-116996545 AAGTGTCTTCAGCTGGAGTGGGG - Intronic
1075059583 10:119246383-119246405 AAGAGTTTTCAGTTGGAGGGTGG + Intronic
1078633044 11:13022215-13022237 ATGTGTATTCAGCTGTAGTTGGG + Intergenic
1080792945 11:35537583-35537605 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1080991365 11:37539871-37539893 CTGTGTCTTCACATGGAGGGAGG - Intergenic
1081120129 11:39256021-39256043 AGGTGGTCTCAGATGGAGAGAGG - Intergenic
1081397928 11:42609514-42609536 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1081549562 11:44098745-44098767 ATGTGTTTGCATATGGTGGGTGG + Intronic
1081994769 11:47356308-47356330 ATGTGTAAGCAGATGCAGTGTGG - Intronic
1083093750 11:60227537-60227559 ATATATTTTGAGATGGAGTCTGG - Intronic
1083277420 11:61604886-61604908 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1084075325 11:66770690-66770712 ATTTGTTTTGAGATAGAGTCTGG - Intronic
1084124086 11:67087410-67087432 GTTTGTTTTTAGATGGAGTCTGG + Intergenic
1084325121 11:68395810-68395832 CTGTGTTTTCTGCTGGAGTTTGG + Intronic
1086668735 11:89520393-89520415 TTGTGTTTGCTGATAGAGTGAGG - Intergenic
1087668879 11:101082538-101082560 AGGTGGTCTCAGATGGAGTGAGG + Intronic
1088037198 11:105332335-105332357 ATGTGTTCTCAGTTGGAATCTGG + Intergenic
1088741952 11:112774500-112774522 ACGTGTTTTCACATTGGGTGGGG + Intergenic
1089507477 11:118973427-118973449 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1089844812 11:121450579-121450601 ATGTTATTTCAGAGGGATTGAGG - Intergenic
1090137227 11:124210495-124210517 CTGTGGTTGGAGATGGAGTGTGG - Intergenic
1091908093 12:4205679-4205701 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1092604244 12:10101506-10101528 ATGTGGTTGCACAGGGAGTGGGG - Intronic
1093421751 12:18982004-18982026 ATGTGTGTTCAGGTGGAGTGTGG - Intergenic
1093429320 12:19066080-19066102 ATGTTATTTTAAATGGAGTGTGG + Intergenic
1093553715 12:20446349-20446371 GAGTGTTTTGAGATGGGGTGAGG + Intronic
1093648593 12:21617620-21617642 TTTTTTTTTCAGATGGAGTTTGG + Intergenic
1095254450 12:40018213-40018235 ATGTATTTTAAAAAGGAGTGTGG - Intronic
1096159569 12:49366007-49366029 ATATTTTTTGAGATGGAGGGTGG + Intergenic
1096585504 12:52617174-52617196 AGGAGTTTTCAGATGGAGGTGGG - Intronic
1097354343 12:58584826-58584848 ATGTGTTTCCAGAAGGATTTAGG + Intronic
1097513438 12:60571883-60571905 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
1098614582 12:72507430-72507452 ATGAGTTCTCAGATGGAGATGGG + Intronic
1098878010 12:75887182-75887204 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1099129958 12:78816159-78816181 GTTTTTTTTCAGATGGAGTCTGG - Intergenic
1099536288 12:83849135-83849157 AATTGTTTTCAGAGGGACTGTGG + Intergenic
1099538549 12:83875837-83875859 ATTTATTTTGAGATGGAGTTTGG + Intergenic
1100256548 12:92888563-92888585 TTGTTTTTTTAGATGGAGTCTGG - Intronic
1103878509 12:124148082-124148104 TTTTGTTTTGAGATGGAGTTTGG + Intronic
1104659867 12:130603461-130603483 TTGTGTTTTGAGATGCACTGGGG - Intronic
1105500260 13:20965672-20965694 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1105656383 13:22444501-22444523 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1105744807 13:23367603-23367625 TTGTTTTTTGAGACGGAGTGTGG + Intronic
1105836103 13:24213276-24213298 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1105870179 13:24497583-24497605 ATGTGTTCTCTTTTGGAGTGTGG - Intronic
1106244159 13:27932994-27933016 TTATTTTTTGAGATGGAGTGTGG - Intergenic
1106384203 13:29268269-29268291 ATGTTTTTTGAGATGGACAGCGG + Intronic
1107093180 13:36505240-36505262 ATGTGTTTTCTGTTGAATTGGGG + Intergenic
1107399749 13:40057725-40057747 ATGTGGTTCCACTTGGAGTGGGG + Intergenic
1108617822 13:52151690-52151712 ATGTGTTCTCAGATGGAAAACGG - Intronic
1108941413 13:55960336-55960358 ATGTGTATTCGGCTGTAGTGGGG - Intergenic
1109054218 13:57526493-57526515 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1109910491 13:68904932-68904954 ATGAGGTTTCAGATGGAGATGGG + Intergenic
1111232389 13:85361024-85361046 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1111761278 13:92468700-92468722 ATGTGTTTTTAGATGGAAACTGG + Intronic
1112242628 13:97696917-97696939 AGGACTCTTCAGATGGAGTGAGG - Intergenic
1112871405 13:103975238-103975260 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
1114013629 14:18402535-18402557 ATATTTTTTGAGATGGAGTCTGG - Intergenic
1115213246 14:30989470-30989492 ATTTATTTTGAGATGGAGTCTGG + Intronic
1115256924 14:31412861-31412883 ATTTTTTTTGAGATGGAGTTTGG - Intronic
1115311053 14:31978737-31978759 ATGTATTTTCAGTTGTTGTGTGG + Intergenic
1115994240 14:39178746-39178768 ATTTTTTTTGAGATGGAGTTTGG + Intronic
1117104069 14:52381056-52381078 AAGTGTTTCCAGAGGTAGTGGGG + Intergenic
1117785337 14:59278181-59278203 CTGTGTGATCAGATGAAGTGAGG + Intronic
1118283014 14:64446551-64446573 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1118295675 14:64566706-64566728 ATGTGTGTGCAGAGGGAATGGGG - Intronic
1118655128 14:67939213-67939235 ATGTGTTTCCACATGGAGGGGGG - Intronic
1118823065 14:69357677-69357699 CTTTGTTTTCAGATGGCTTGAGG - Intergenic
1119478725 14:74946838-74946860 ATGTTGTTCCGGATGGAGTGGGG - Intronic
1120211019 14:81633964-81633986 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1122753146 14:103954638-103954660 ATTTTTTTTGAGATGGAATGTGG + Intronic
1123046125 14:105516700-105516722 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1123416607 15:20100238-20100260 TCTTTTTTTCAGATGGAGTGTGG + Intergenic
1123525945 15:21107344-21107366 TCTTTTTTTCAGATGGAGTGTGG + Intergenic
1124806981 15:32894056-32894078 AGCTGTTTTCTGGTGGAGTGAGG - Intronic
1125022990 15:35003385-35003407 ATGTGCTGTCAGAGGAAGTGGGG + Intergenic
1125365831 15:38914644-38914666 ATGTGATTTCAGGTGGAGAATGG + Intergenic
1125673590 15:41490681-41490703 CTTTGTTTTGAGATGGAGTCTGG + Intergenic
1125955851 15:43790773-43790795 ATTTATTTTGAGATGGAGTCTGG + Intronic
1126402982 15:48293404-48293426 ATTTGATTTCATGTGGAGTGGGG + Intronic
1126424327 15:48510235-48510257 ATGAGTTTGCAAATGGAGGGAGG - Intronic
1126745213 15:51818983-51819005 TTGTTTTTTTAGATGGAGTCTGG + Intergenic
1126784400 15:52164614-52164636 ATTTATTTTGAGATGGAGTCTGG - Intronic
1126927747 15:53609426-53609448 TTGTATTTTCAGATAGAGGGGGG + Intronic
1127878030 15:63128753-63128775 ATTTATTTTGAGATGGAGTCTGG + Intronic
1128052576 15:64676763-64676785 ATTTATTTTGAGATGGAGTCTGG + Intronic
1128266190 15:66268528-66268550 ATGTATTTTCTGATTCAGTGAGG - Intergenic
1128291252 15:66480098-66480120 ATATTTTTTGAGATGGAGTCTGG + Intronic
1128602686 15:69011122-69011144 TTTTTTTTTCAGATGGAGTTTGG - Intronic
1129574732 15:76730632-76730654 ATGTGTTTTCAGATATAATATGG - Intronic
1130211392 15:81926220-81926242 ATGTGTTTTCAGGCTGAATGTGG - Intergenic
1130372997 15:83302960-83302982 ATGTGTTTAGAGTTGGAGAGGGG + Intergenic
1130601037 15:85273396-85273418 CTGTGTTTTAATTTGGAGTGGGG + Intergenic
1131448639 15:92520416-92520438 ATTTATTTTCAGATGGAGTCTGG - Intergenic
1131745420 15:95442319-95442341 ATGTGTATTAAGAAGCAGTGTGG + Intergenic
1132341389 15:101080495-101080517 TTGTGTTTTGAGATGGAGTCTGG + Intergenic
1132395097 15:101466907-101466929 AAATGTTATCAGATGGGGTGCGG + Intronic
1132832920 16:1938196-1938218 TTTTGTTTTGAGATGGGGTGGGG - Exonic
1133399134 16:5471933-5471955 GTGTGTTTTTGGCTGGAGTGTGG + Intergenic
1133788804 16:8993428-8993450 ATATTTTTTGAGATGGAGTCTGG + Intergenic
1134136693 16:11681192-11681214 ATGTGTTTTCAGTTGTTGTGGGG - Intronic
1134154375 16:11830816-11830838 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1135011663 16:18885932-18885954 ATTTTTTTTGAGATGGAGTCTGG - Intronic
1135338299 16:21623781-21623803 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1135338687 16:21627939-21627961 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1135350047 16:21721203-21721225 ATGTGTTTTCAGAATGGGCGTGG - Intronic
1136443452 16:30294957-30294979 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
1136574621 16:31116221-31116243 ATTTTTTTTGAGATGGAGTCTGG + Intronic
1137737074 16:50732549-50732571 ATGTGATCCCAGCTGGAGTGTGG - Exonic
1138478551 16:57286270-57286292 TTTTGTTTTTAGATGGAGTCTGG - Intergenic
1138497723 16:57418343-57418365 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1139443832 16:66984439-66984461 TTGTTTTTTTAGATGGAGTCTGG + Intergenic
1140299483 16:73742336-73742358 ATGTGTTTGAAGAGGGTGTGTGG + Intergenic
1140348000 16:74233675-74233697 TTATTTTTTCAGATGGAGTCTGG - Intergenic
1140888318 16:79263667-79263689 CTGTGTTTGCATGTGGAGTGGGG + Intergenic
1141457464 16:84152943-84152965 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1141814115 16:86397793-86397815 ATGTGTCTACAGATTGGGTGGGG + Intergenic
1142574096 17:894811-894833 TTATGTTTTCAGATGGAAGGGGG - Intronic
1142845922 17:2676364-2676386 GTTTGTTTTCAGACGGAGTCTGG - Intronic
1143558586 17:7677973-7677995 TTGTTTTTTGAGATGGAGTTTGG + Intronic
1143741058 17:8954400-8954422 CTGTGTTTTCAGAGGGAGTAAGG - Intronic
1143789468 17:9282142-9282164 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1143830461 17:9646334-9646356 AGGTATTTTGAGAGGGAGTGGGG + Intronic
1145252192 17:21302757-21302779 AAATGTTTCCAGATGCAGTGAGG - Intronic
1145837139 17:27963117-27963139 ATGTCTTTTAAGCTGGAGAGGGG - Intergenic
1146041324 17:29457415-29457437 TTTTTTTTTGAGATGGAGTGTGG + Intronic
1146639819 17:34531841-34531863 GTGTGTGTATAGATGGAGTGAGG - Intergenic
1147286494 17:39406512-39406534 ACATGTTTTCAGATGCAGTAAGG - Intronic
1148159715 17:45443010-45443032 ATGTGTGTGTGGATGGAGTGAGG + Intronic
1148246860 17:46037905-46037927 AACTGCTTCCAGATGGAGTGTGG + Intronic
1148290484 17:46444016-46444038 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1148312652 17:46661589-46661611 GTTTGTTTTGAGATGGAGTCTGG + Intronic
1148925890 17:51084860-51084882 ATTTTTTTTGAGATGGAGTCTGG + Intronic
1148977064 17:51538910-51538932 TTGTATTTTCACATGGGGTGGGG + Intergenic
1149247279 17:54725266-54725288 ATGTGTTGTCAGATGGAAGGAGG + Intergenic
1149686259 17:58537013-58537035 GTGTATTTTCAGAAGGTGTGTGG - Intronic
1150391001 17:64789882-64789904 ATGTGTGTGTGGATGGAGTGAGG + Intergenic
1150928252 17:69556868-69556890 ATGTGTTGTCAGATGGTGGCTGG + Intergenic
1150977581 17:70105991-70106013 CTGAGAATTCAGATGGAGTGCGG + Intronic
1151263361 17:72934652-72934674 TTTTATTTTGAGATGGAGTGTGG - Intronic
1152702344 17:81825337-81825359 GTGTGTCCTCAGCTGGAGTGGGG - Exonic
1152963458 18:95000-95022 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
1153503548 18:5772123-5772145 ATGGGTTCTCAGACGAAGTGTGG + Intergenic
1154153818 18:11928316-11928338 TTTTGTTTTTAGATGGAGTTTGG - Intergenic
1154351899 18:13590266-13590288 ATGTGTGTGCATATGGAGTGTGG + Intronic
1154511432 18:15107382-15107404 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1155267361 18:24106701-24106723 TTGTGTTTTGAGACGGAGTCTGG + Intronic
1155357590 18:24968403-24968425 AACGGTTTTCAGATGGAGTCAGG + Intergenic
1155853439 18:30801502-30801524 TTGTGTTTTCAGTAGTAGTGGGG - Intergenic
1156040017 18:32810026-32810048 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
1156957465 18:42986048-42986070 TTTTTTTTTTAGATGGAGTGTGG + Intronic
1157356656 18:46941325-46941347 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1157476707 18:48028565-48028587 ATGTGTTTAGAGGTGGAGGGCGG + Exonic
1158135843 18:54207247-54207269 ATGTCTTTCCAGATGGAAGGAGG + Intronic
1158331049 18:56362532-56362554 ATTATTTTTGAGATGGAGTGTGG + Intergenic
1158858842 18:61572040-61572062 ATTTATTTTGAGATGGAGTCAGG - Intergenic
1159190894 18:65040847-65040869 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1159244499 18:65788080-65788102 ATGTGTGTTCAAATGAAGGGTGG - Intronic
1160245271 18:77153648-77153670 CTGTGTTTTCACATGGTGGGAGG - Intergenic
1161825814 19:6564370-6564392 CTGTGTTTTCATCTGGAGTCTGG - Intergenic
1163495719 19:17645569-17645591 ATGTGTTCTCAGGAGGAGTTTGG - Intronic
1165498957 19:36172176-36172198 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1165959336 19:39521319-39521341 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1166165016 19:40981315-40981337 AGGTGGTTTCAGATGGAGAAGGG - Intergenic
1166710285 19:44932517-44932539 ATTTTTTTTGAGATGGAGTCTGG + Intergenic
1167050239 19:47073558-47073580 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1167479207 19:49719070-49719092 TTGTTTTTTGAGATGGAGTTTGG - Intergenic
1168138439 19:54367732-54367754 ATATTTTTTTAGATGGAGTCTGG - Intronic
1168157036 19:54480078-54480100 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1168302119 19:55411120-55411142 TTGAGTTTTCAGCTGGGGTGGGG - Intergenic
1168498201 19:56871773-56871795 GTTTGTTTTGAGATGGAGTTTGG - Intergenic
925392478 2:3505891-3505913 CTGTGTTTTCACATGGTGGGTGG - Intronic
926076468 2:9947060-9947082 TTGTTTTTTGAGATGGAGTTTGG - Intergenic
926211738 2:10876066-10876088 ATTTATTTTGAGATGGAGTTTGG + Intergenic
926302503 2:11614573-11614595 TTTTGTTTTGAGATGGAGTCTGG + Intronic
926651307 2:15349372-15349394 ATGTGTTTTCACATCCAATGAGG + Intronic
926668059 2:15546714-15546736 TTTTGTTTTCAGACGGAGTCTGG - Intronic
927657252 2:24959665-24959687 ATCTGTTTCCAGATGGAGTTAGG - Intronic
928236153 2:29542833-29542855 ATGTGTTTTCTGATTGACAGAGG - Intronic
928385751 2:30866492-30866514 CTGTGGTTTCAGATGGCTTGGGG - Intergenic
928545864 2:32328728-32328750 ATTTATTTTGAGATGGAGTCTGG + Intergenic
928769693 2:34692185-34692207 ATTTTTTTTGAGATGGAGTCTGG + Intergenic
929148996 2:38731213-38731235 GTTTGTTTTGAGATGGAGTCTGG - Intronic
929170037 2:38922580-38922602 ATGTGTATTCAGTTGAAATGAGG - Intronic
929570177 2:43017985-43018007 TTCTGATTTCAGAAGGAGTGAGG + Intergenic
929792112 2:45031061-45031083 ATGAGTTTTGGGGTGGAGTGAGG + Intergenic
930202588 2:48559398-48559420 ATGTGTTCTCAGATGGCGGAAGG + Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
930793558 2:55361072-55361094 AAGTTTTTTGAGATGGAGTCTGG - Intronic
931908294 2:66866866-66866888 CTGTGTTCCCTGATGGAGTGGGG + Intergenic
932228788 2:70065081-70065103 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
932817605 2:74874337-74874359 ATGTGTATCAATATGGAGTGGGG + Exonic
933445660 2:82377163-82377185 AAGTGGTTTCAGATGGAGATGGG + Intergenic
934747921 2:96771700-96771722 TTTTTTTTTGAGATGGAGTGTGG - Intronic
935787302 2:106560682-106560704 ATGCGGTTTGAGAGGGAGTGAGG + Intergenic
935984389 2:108658689-108658711 CTGTGTTTTAAGGTGTAGTGAGG + Intronic
936136827 2:109902337-109902359 CTGTGTTTTAAGGTGTAGTGAGG + Intergenic
936207870 2:110469148-110469170 CTGTGTTTTAAGGTGTAGTGAGG - Intronic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937226237 2:120371620-120371642 ATCTGTGGACAGATGGAGTGTGG - Intergenic
937390102 2:121478587-121478609 GTGTGTTTTGAGACGGAGTCTGG - Intronic
938008250 2:127806759-127806781 ATATGTTTTCAGCTGGAGACTGG + Intronic
939729294 2:145762201-145762223 ATGTGATTTCAGATGGCTTGAGG + Intergenic
939771163 2:146321110-146321132 ATGAGTTCTCAAATGCAGTGTGG - Intergenic
941026744 2:160464133-160464155 ATGTGTCTGCAAGTGGAGTGGGG - Intronic
941335765 2:164241462-164241484 AGGTGTTCTCAGATGAAATGAGG - Intergenic
941710124 2:168703544-168703566 TTGTTTTTTGAGATGGAGTCTGG - Intronic
942016874 2:171826595-171826617 ATATTTTTTGAGATGGAGTCTGG - Intronic
942898299 2:181084608-181084630 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
943369731 2:187002198-187002220 ATTTCTTCTCAGATGGGGTGCGG - Intergenic
943742857 2:191429491-191429513 ATGTATTTTCTCATGGTGTGTGG + Intergenic
943910277 2:193556442-193556464 ATGTATTTTCAGAAGGAGGTAGG - Intergenic
944143314 2:196480174-196480196 ATGTGATTTGAGTAGGAGTGTGG - Intronic
944409332 2:199422486-199422508 ATGTATTTTAAAATTGAGTGGGG - Intronic
944509949 2:200454704-200454726 ATGTGTTTTTAGAAGGAGAAAGG + Intronic
944687548 2:202131148-202131170 GTTTGTTTTGAGATGGAGTCTGG + Intronic
945398791 2:209354397-209354419 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
946828644 2:223705246-223705268 CTGTGTCTTCAGATAGATTGAGG + Intergenic
946881231 2:224179187-224179209 ATGTGCTTTCTGGTGGAGGGAGG + Intergenic
946971610 2:225098893-225098915 TTTTTTTTTTAGATGGAGTGAGG - Intergenic
947565759 2:231191928-231191950 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
948354450 2:237366850-237366872 AAGTGTTTGCTGTTGGAGTGAGG - Exonic
1169310904 20:4538859-4538881 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1169730083 20:8777182-8777204 CTGTGTTTTCACTAGGAGTGAGG + Intronic
1170232785 20:14068958-14068980 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1170373751 20:15678050-15678072 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1170965218 20:21062228-21062250 TTTTTTTTTGAGATGGAGTGTGG - Intergenic
1172155670 20:32822154-32822176 ATGTTTTTTGAGCTGGGGTGTGG + Intronic
1173635785 20:44556372-44556394 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1174230206 20:49040142-49040164 ATATTTTTTGAGATGGAGTCTGG + Intergenic
1174477045 20:50802860-50802882 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1175157270 20:56979606-56979628 GTTTGTTTTGAGATGGAGTCCGG + Intergenic
1176191521 20:63812764-63812786 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1177647761 21:23921505-23921527 ATGAGTTTACAGATTGACTGGGG - Intergenic
1178841484 21:36140994-36141016 TTTTTTTTTGAGATGGAGTGTGG - Intronic
1178891153 21:36522242-36522264 ATGCATTTTCACATGAAGTGGGG - Intronic
1179454041 21:41486309-41486331 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1180018712 21:45105110-45105132 TTGTTTTTTTAGATGGAGTCTGG + Intronic
1180438124 22:15333350-15333372 ATATTTTTTGAGATGGAGTCTGG - Intergenic
1180835950 22:18929506-18929528 GTGTGTTCTCAGAAGGAGTCTGG - Intronic
1180909212 22:19436975-19436997 TTGTGTTTTCAGCTGGGGTTAGG + Intronic
1182064563 22:27421180-27421202 ATGTGGTTGCAGCTGGAGGGGGG - Intergenic
1182297441 22:29318126-29318148 ATGTGTTTTTGGATGGCGAGGGG + Intronic
1182975950 22:34624277-34624299 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1185378376 22:50493807-50493829 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
949581152 3:5389767-5389789 TTTTTTTTTGAGATGGAGTGTGG + Intergenic
949658310 3:6247438-6247460 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
950378233 3:12589800-12589822 TTTTTTTTTCAGATGGAGTCTGG + Intronic
950625035 3:14239154-14239176 ATGTGTTTTCAGTTGTACTCAGG + Intergenic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952478387 3:33734480-33734502 CTGTGTTCTCACATGGGGTGGGG - Intergenic
952492010 3:33882099-33882121 GTGTGCTTTCATGTGGAGTGGGG + Intergenic
952825860 3:37524241-37524263 AGGTGTTTCAAGATGGAGTGGGG + Intronic
954611473 3:51946737-51946759 TTATTTTTTCAGATGGAGTCTGG - Intronic
955034527 3:55253567-55253589 ATGAGTTTTCAGATTGAAGGAGG + Intergenic
956020026 3:64924298-64924320 AGGTGTTTACAGGAGGAGTGAGG + Intergenic
956832348 3:73063615-73063637 ATTTTTTTTTAGATGGAGTCTGG - Intronic
956986586 3:74708614-74708636 ATTTATTTTGAGATGGAGTCTGG + Intergenic
957153775 3:76520437-76520459 ATTTTTTTTGAGATGGAGTCTGG - Intronic
957198830 3:77106052-77106074 GTTTGTTTTGAGATGGAGTCTGG + Intronic
957446824 3:80324253-80324275 ATGTGTTTTCAGAAGCATTGGGG + Intergenic
958157386 3:89772061-89772083 AGGTGTTCTCAAATGGAATGAGG - Intergenic
958542654 3:95499292-95499314 TTTTGTTTTGAGATGGAGTCCGG - Intergenic
958543294 3:95508718-95508740 ATTTATTTTGAGATGGAGTCTGG - Intergenic
959432371 3:106270720-106270742 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
959785756 3:110295448-110295470 AGGTGGTCTCAGATGGAATGAGG - Intergenic
960214079 3:115009298-115009320 ATCTGAATTCAGATGGGGTGGGG - Intronic
961146475 3:124598199-124598221 CTGTGATTTCAGATGGACTTGGG - Intronic
961790194 3:129370366-129370388 ATGTGTATGCATATGGTGTGTGG + Intergenic
962491557 3:135898358-135898380 TTTTGTTTTCAGATGGAGTCTGG + Intergenic
962589239 3:136872237-136872259 AGGTGGTTTCAGATGGAGATGGG + Intronic
962634901 3:137320572-137320594 ATGTGTTTTCATAAGGTGAGTGG + Intergenic
962843538 3:139255864-139255886 AAGTGTTTGCAGTGGGAGTGAGG + Intronic
962891883 3:139679165-139679187 CTGTGTCTTCAGACTGAGTGGGG - Intergenic
964543858 3:157810655-157810677 GTTTGTTTTGAGACGGAGTGAGG - Intergenic
964998786 3:162925121-162925143 TTTTGTTTTGAGATGGAGTTTGG - Intergenic
965363468 3:167769004-167769026 GTTTGTTTTGAGATGGAGTGTGG + Intronic
965542832 3:169887644-169887666 ATGTGTGTGGAGAGGGAGTGAGG - Intergenic
966138933 3:176732922-176732944 ATGTATTTTCATATGCAGAGTGG + Intergenic
966570826 3:181441270-181441292 ATGTGATTACACATGTAGTGGGG + Intergenic
966973229 3:185064265-185064287 ATTTGTTTTGAGATGGAGTCTGG - Intergenic
967839792 3:193996107-193996129 AGGTATTTTCAGAGGGTGTGAGG + Intergenic
968176809 3:196557636-196557658 ATTTGTTTTCAGATGCAGAAAGG + Intronic
970559697 4:17270466-17270488 ATGGGTTTTCAGACAGAGCGAGG - Intergenic
971699420 4:29950228-29950250 ATTTATTTTGAGATGGAGTCTGG - Intergenic
972373735 4:38450689-38450711 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
972499240 4:39662215-39662237 ATATTTTTTGAGATGGAGTCTGG + Intergenic
972510812 4:39767338-39767360 TTGTTTTTTGAGATGGAGTCTGG + Intronic
972619561 4:40733765-40733787 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
975096218 4:70460474-70460496 TTTTTTTTTGAGATGGAGTGGGG + Intronic
975688786 4:76945900-76945922 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
975782163 4:77850656-77850678 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
976039803 4:80869817-80869839 ATGTGTTTTTAGGTGCAGTGGGG + Intronic
976989243 4:91344197-91344219 ATGTGTTCTCACATGGAGGAAGG - Intronic
977381477 4:96279612-96279634 GTGTGTTTACATAGGGAGTGAGG + Intergenic
978460412 4:108945674-108945696 TTGTTTTTTGAGATGGAGTCTGG + Intronic
978543170 4:109840999-109841021 ATTTGTTTCCAGATTGAGTTTGG - Intronic
979037065 4:115734436-115734458 ATGTGTTTTCATATATAGTAAGG + Intergenic
979302502 4:119102963-119102985 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
980604630 4:135074143-135074165 ATGTGGTTTGTGATGGAGTTTGG - Intergenic
980682758 4:136186052-136186074 ATTTGTTTTAATATGGTGTGAGG - Intergenic
980784380 4:137533058-137533080 AAGTATTTACAGAGGGAGTGGGG - Intergenic
981863196 4:149381767-149381789 ATGTATTTTTAGATGGAGTTTGG + Intergenic
982981233 4:162138829-162138851 ATACGTTTTCTGATGGAATGTGG - Intronic
983231569 4:165134433-165134455 ATTTTTTTTCAGTTGGAGTCTGG + Intronic
983279424 4:165661812-165661834 ATGTATTTTTTGATGGAGTTTGG + Intergenic
984026245 4:174547028-174547050 AGGTGTTCTCAGATGGAGATGGG + Intergenic
984643832 4:182199408-182199430 TTGTTTTTTGAGATGGAGTCTGG - Intronic
984963177 4:185117834-185117856 ATGTGGTTTCATATGTAATGTGG + Intergenic
985254940 4:188060638-188060660 TTTTGTTTTGAGATGGAGTCTGG - Intergenic
987715620 5:21565784-21565806 ATGTATTTTCTGATTGAGTGTGG + Intergenic
988340487 5:29963689-29963711 ATGTGTCTTCTGATGGATTGTGG - Intergenic
988567686 5:32332763-32332785 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
988916630 5:35900892-35900914 ATGTATTCACAGATGGTGTGTGG - Intergenic
990025552 5:51183352-51183374 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
990029426 5:51239296-51239318 ATTTATTTTGAGATGGAGTCTGG + Intergenic
990849607 5:60187923-60187945 ATGTGTTTTCAAAATGAATGAGG + Intronic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
991333756 5:65523880-65523902 CTGTCTTTTAAGATGGAATGTGG - Intronic
992660702 5:78958051-78958073 TTTTGTTACCAGATGGAGTGTGG - Intronic
992783486 5:80148695-80148717 ATGTGATTTCAGAAGGACTCTGG + Intronic
993003414 5:82405551-82405573 ACATGTTTTGAGATGGAGGGTGG - Intergenic
994820247 5:104640545-104640567 ATCTGGTTTCTTATGGAGTGAGG - Intergenic
995514862 5:112944239-112944261 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
995561549 5:113387165-113387187 ATGAGTCTTCAGATAGATTGGGG - Intronic
995625255 5:114069314-114069336 ATTTTTTTTCTGATGGAGGGTGG - Intergenic
996304617 5:122032962-122032984 GTTTGTTTTGAGATGGAGTCTGG + Intronic
996803827 5:127432446-127432468 ATGTGTTTTCATTTGGTCTGAGG + Intronic
997463954 5:134074291-134074313 ATTTATTTTGAGATGGAGTCTGG - Intergenic
997482180 5:134194377-134194399 GTTTGTTTTCAGATGGATTTTGG - Exonic
997512468 5:134463114-134463136 ATCTGGTTTCAGAAGGATTGAGG - Intergenic
997970893 5:138400810-138400832 ATGGGTTGTCAGGTGGGGTGTGG - Intronic
998273485 5:140728751-140728773 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
998565751 5:143214589-143214611 ATGTGTTTACAGATGCAGCCAGG - Intronic
999292113 5:150432603-150432625 ATTTTTTTTGAGATGGAGTCTGG - Intergenic
1000083934 5:157872657-157872679 TTTTTTTTTGAGATGGAGTGTGG - Intergenic
1000346383 5:160317829-160317851 TAGAGTTTTCAGAGGGAGTGTGG - Intronic
1003651093 6:7961161-7961183 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1003848807 6:10201140-10201162 ATTTTTTTTGAGATGGAGTCTGG + Intronic
1004424880 6:15500539-15500561 ATGTGTTGTCACATGGAGGCGGG - Intronic
1004667679 6:17763462-17763484 TTTTTTTTTGAGATGGAGTGTGG - Intronic
1005584909 6:27267088-27267110 ATGAGTTCTCAGAAGGAATGTGG - Intergenic
1006563269 6:34932194-34932216 TTTTGTTTTGAGATGGAGTCTGG + Intronic
1006815909 6:36849707-36849729 ATATTTTTTCAGCTGGAGGGAGG + Intergenic
1007433388 6:41789465-41789487 ATGTGTTTTCAGATGTTGAAAGG + Intronic
1007447164 6:41915773-41915795 GTGTGTTTTGAGACGGAGTCTGG - Intronic
1009001105 6:57716266-57716288 ATGTATTTTCTGATTGAGTGTGG - Intergenic
1009900633 6:69803881-69803903 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1011010627 6:82699694-82699716 ATATGTTTTAAGATGTAGCGAGG + Intergenic
1011125492 6:84002937-84002959 ATGTGTTTGTAATTGGAGTGTGG + Intergenic
1011841067 6:91499559-91499581 CTGTGTCCTCATATGGAGTGGGG + Intergenic
1012868754 6:104648287-104648309 AAGTGTGTCCAGATGGAATGTGG + Intergenic
1013402478 6:109812326-109812348 ATGTGCTGTGGGATGGAGTGAGG + Intronic
1013608169 6:111769985-111770007 ATGTGGTTTTAGATGGGGGGAGG + Intronic
1014448062 6:121551937-121551959 ATTTTTTTTGAGATGGAGTCTGG + Intergenic
1015006863 6:128293356-128293378 CTGTGTTTTCACATGGTGAGTGG + Intronic
1016454872 6:144220436-144220458 ATGTGTTTTAAAATGTACTGTGG + Intergenic
1016607211 6:145943974-145943996 TTTTGTTTTGAGATGAAGTGAGG - Intronic
1016804354 6:148197859-148197881 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1017800628 6:157892424-157892446 ATGTGTTATCAGCAGGAGTTGGG + Intronic
1018450502 6:163902941-163902963 TTGTTTTTTGAGATGGAGTTTGG + Intergenic
1018529363 6:164746072-164746094 ATGTGTTATCAGTTGTAGAGAGG - Intergenic
1018990874 6:168672772-168672794 ATGTGTTTTCAGATGGAGTGAGG + Intronic
1019220993 6:170472713-170472735 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1019455308 7:1123729-1123751 GAGGGTTTTCAGATGGAGTGTGG - Intronic
1019566255 7:1680561-1680583 ATGGGCTTGCAGATGGAGAGTGG - Intergenic
1019889254 7:3932882-3932904 CTGTGTGTTCAGATAGGGTGTGG + Intronic
1021484227 7:21149160-21149182 ATGTCTTATGATATGGAGTGAGG - Intergenic
1021506563 7:21391795-21391817 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1021675091 7:23072516-23072538 ATAGGTTTCCAGATGCAGTGAGG + Intergenic
1021975469 7:26007633-26007655 TTGTTTTTTCAGGTGCAGTGAGG - Intergenic
1022551879 7:31248356-31248378 TTTTTTTTTGAGATGGAGTGTGG - Intergenic
1023060121 7:36318579-36318601 ATTTGTTTTGAGATGGAGGCTGG - Intergenic
1023368174 7:39486045-39486067 GTTTGTTTTGAGATGGAGTCTGG + Intronic
1023603583 7:41906122-41906144 ATGAGTTTTCAGATTGATTGTGG + Intergenic
1024369595 7:48565619-48565641 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1024723993 7:52171347-52171369 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1025719107 7:63993333-63993355 ATTTTTTTTTAGATGGAGTCTGG + Intergenic
1025873106 7:65453455-65453477 ATGTGTTTTGAGGGGGAGGGAGG - Intergenic
1025992769 7:66508107-66508129 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1026282775 7:68936404-68936426 TTTTTTTTTCAGATGGAGTCTGG - Intergenic
1026728804 7:72893570-72893592 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1027114976 7:75471895-75471917 TTGTTTTTTGAGATGGAGTCTGG + Intronic
1027584899 7:80045445-80045467 AGGTGCTTTCAGATGGAGATGGG - Intergenic
1027598133 7:80202100-80202122 TTGTTTTTTGAGATGGAGTCGGG + Intronic
1028575369 7:92343652-92343674 ATGTATTTTGAGATGGGGTCTGG - Intronic
1028922143 7:96321320-96321342 AAGTGTTGTCAGATGGAGAGAGG + Intronic
1029249378 7:99225149-99225171 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1029580418 7:101433474-101433496 AGGTGTTTCCAGAGGGAGGGTGG + Intronic
1029939534 7:104465143-104465165 AGGTGGTTTCAGATGGAGATGGG - Intronic
1030348733 7:108459782-108459804 CTGGGTTTGAAGATGGAGTGAGG - Intergenic
1030436677 7:109530478-109530500 ATGAGATTTCAGATGGAATTGGG - Intergenic
1030667626 7:112297905-112297927 ATGTGTCTGCAGATGGACTCAGG + Intronic
1030977392 7:116143752-116143774 ATATGTTTGCAGAAGGAGTAGGG - Intronic
1032214133 7:129943570-129943592 TTGTGTTTTTAGACGGAGTCTGG - Intronic
1032790317 7:135237878-135237900 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1032891608 7:136200841-136200863 TTTTTTTTTGAGATGGAGTGTGG + Intergenic
1033341768 7:140497743-140497765 ATTTTTTTTGAGATGGAGTCGGG + Intergenic
1033456502 7:141508302-141508324 AGGTGGTCTCAGATGGAGTGAGG - Intergenic
1033778006 7:144634599-144634621 ATTTTTTTTGAGATGGAGTCTGG + Intronic
1034105774 7:148488533-148488555 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1034342465 7:150366861-150366883 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1035821265 8:2594752-2594774 TTGTTTTTTGAGATGGAGTCTGG + Intergenic
1036277088 8:7363528-7363550 ATCTGTTTTAGGGTGGAGTGTGG + Intronic
1036462621 8:8967097-8967119 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1036828305 8:11997897-11997919 ATGTGTATTCTGTTGGTGTGTGG - Intergenic
1037509527 8:19567741-19567763 ATGTGTTTTCATTTGGATTTTGG - Intronic
1037701023 8:21273899-21273921 ATGGGTTTTCAGCTGGAGGAGGG + Intergenic
1037984089 8:23275985-23276007 ATGGGAACTCAGATGGAGTGAGG - Intronic
1038958932 8:32497555-32497577 AAGTGTTTTCAGAGGCATTGGGG + Intronic
1040513489 8:48116215-48116237 GTTTGTTTTGAGATGGAGTCTGG + Intergenic
1040950943 8:52939025-52939047 CTATTATTTCAGATGGAGTGAGG + Exonic
1041164984 8:55082655-55082677 ATTGGGTTTCAGATGAAGTGAGG + Intergenic
1042165746 8:65944378-65944400 ATGTGTTTGCAACTAGAGTGGGG + Intergenic
1043581322 8:81719493-81719515 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1044326828 8:90868477-90868499 AGGTGGTTTCAGATGGAGATGGG + Intronic
1044512577 8:93099271-93099293 ATGTGGTGTGAGATGGAGTAGGG + Intergenic
1044898304 8:96916718-96916740 ATGTGACTTCAAATGTAGTGTGG - Intronic
1045051538 8:98331661-98331683 ATGTGGTTTTAGATGCACTGTGG + Intergenic
1045900050 8:107267170-107267192 TTGTATTTTCACATGGAGAGAGG - Intronic
1046248440 8:111597515-111597537 ATCTGTTTTCATGTGGATTGTGG + Intergenic
1046560667 8:115833085-115833107 TTGTTTTTTGAGATGGAGTCTGG - Intergenic
1046923742 8:119764132-119764154 ATTTTTTTTGAGATGGAGTCTGG - Intronic
1047283563 8:123466600-123466622 AATTGTTTTCATCTGGAGTGAGG + Intronic
1047537365 8:125732083-125732105 CTGTGTCTTCAGGTGGACTGAGG + Intergenic
1047564851 8:126032774-126032796 ATGTGTTGTCAAATGAAATGAGG - Intergenic
1047843121 8:128776136-128776158 ATGTGTTATGAGATGAATTGAGG + Intergenic
1048495730 8:134934469-134934491 ATGGGTTTTCTGATTGACTGTGG + Intergenic
1049632672 8:143667028-143667050 ATGTGTGTGCACATGGAGGGAGG - Intergenic
1049729660 8:144169652-144169674 ATGTTTTTTGAGATGGAATTTGG + Intronic
1049729684 8:144169843-144169865 ATGTTTTTTGAGATGGAATTTGG + Intronic
1050392762 9:5163604-5163626 CTGTGTTTTAAGATGGATTATGG - Intronic
1050523837 9:6528447-6528469 ATGGGTTTTCAGATGGGGCCAGG + Intergenic
1050579019 9:7031172-7031194 GTATGTTTTGAGATGGAGTCTGG + Intronic
1050600169 9:7242643-7242665 TTTTTTTTTCAGATGGAGTCTGG + Intergenic
1050703957 9:8374231-8374253 AATTGTTTTCAGATAGAGTTTGG - Intronic
1051370984 9:16358839-16358861 AGGTGGTTTCAGCTGCAGTGAGG + Intergenic
1052646235 9:31237628-31237650 ATATGTTTTCAGATGAAAAGTGG + Intergenic
1052835436 9:33246610-33246632 ATGTGTTCACAGATGGGCTGTGG - Exonic
1053051460 9:34964377-34964399 TTATGTTTTCAGATGGAGGGTGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055294614 9:74821395-74821417 AGGTGTTTGCAGGGGGAGTGAGG - Intronic
1055746782 9:79455895-79455917 ATGTGAGTGCAGATAGAGTGTGG + Intergenic
1056469521 9:86892236-86892258 CTGTGTTCTCACCTGGAGTGGGG + Intergenic
1057584008 9:96313582-96313604 ATGTGATTTCAGATGGGGGCTGG - Intergenic
1059795885 9:117696287-117696309 ATGTGTTTTTGGAAGGAATGGGG - Intergenic
1060598656 9:124863164-124863186 ATATTTTTTGAGATGGAGTCTGG + Intronic
1061186249 9:129055835-129055857 TTTTTTTTTCAGATGGAGTCTGG - Intronic
1061764220 9:132871232-132871254 TTTTGTTTTGAGATGGAGTCTGG - Intronic
1185486703 X:487097-487119 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1185743356 X:2551816-2551838 TTCTTTTTTCAGATGGAGTCTGG + Intergenic
1185862062 X:3588974-3588996 ATGTTTTTTGAGATGCAGTTGGG - Intergenic
1189769791 X:44413988-44414010 ATGTGTTTTCAGTTGTTTTGTGG + Intergenic
1190390738 X:49928911-49928933 TTGTTTTTTGAGATGGAGTCTGG - Intronic
1190872700 X:54437915-54437937 GTTTGTTTTGAGATGGAGTCTGG - Intergenic
1193095504 X:77544005-77544027 ATGTGTTATGAGATGGTGTTAGG + Intronic
1193360474 X:80573823-80573845 ATGTGTATCAATATGGAGTGGGG - Intergenic
1194684390 X:96895013-96895035 GTTTGTTTTGAGATGGAGTCTGG + Intronic
1194817702 X:98464532-98464554 TTTTGTTTTGAGATGGAGTCTGG + Intergenic
1195824751 X:108987302-108987324 ATTTGTTTTCTGGTGGATTGTGG + Intergenic
1196410675 X:115414854-115414876 TTTTATTTTCAGATGGAGTCTGG - Intergenic
1197578037 X:128246055-128246077 ATGTAATTTCAGATGGATTAAGG + Intergenic
1198525302 X:137494354-137494376 ATGTGTTTGCTGATGCAGAGAGG - Intergenic
1198926116 X:141798325-141798347 TTGTTTTTTGAGATGGAGTTTGG + Intergenic
1199158961 X:144585587-144585609 TTGTTTTTTGAGATGGAGTTTGG - Intergenic
1199385016 X:147213759-147213781 TTTTGTTTTCAGATGAAGTCTGG + Intergenic
1199386208 X:147226127-147226149 TTTTGTTTTCAGATGAAGTCTGG + Intergenic
1199532136 X:148861784-148861806 ATGTATTTTCAGATGTGGCGGGG - Intronic
1199874274 X:151919165-151919187 ATGTGACTTCAGACGCAGTGGGG - Intronic
1201948722 Y:19540291-19540313 TTGTTTTTTCAGATGGAGTCTGG - Intergenic