ID: 1018991597

View in Genome Browser
Species Human (GRCh38)
Location 6:168677990-168678012
Sequence CTATTCGTATGATGGAAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018991597_1018991606 27 Left 1018991597 6:168677990-168678012 CCTATTTTCCATCATACGAATAG No data
Right 1018991606 6:168678040-168678062 TTATATTACCTTTTTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018991597 Original CRISPR CTATTCGTATGATGGAAAAT AGG (reversed) Intergenic
No off target data available for this crispr