ID: 1018996470

View in Genome Browser
Species Human (GRCh38)
Location 6:168714142-168714164
Sequence CTGTGGTCACGCCCATGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1018996462_1018996470 2 Left 1018996462 6:168714117-168714139 CCTGGCCAAGTGCCCGTCCAGTC No data
Right 1018996470 6:168714142-168714164 CTGTGGTCACGCCCATGCAGGGG No data
1018996460_1018996470 19 Left 1018996460 6:168714100-168714122 CCATCTCTGCCTCAGAGCCTGGC No data
Right 1018996470 6:168714142-168714164 CTGTGGTCACGCCCATGCAGGGG No data
1018996463_1018996470 -3 Left 1018996463 6:168714122-168714144 CCAAGTGCCCGTCCAGTCATCTG No data
Right 1018996470 6:168714142-168714164 CTGTGGTCACGCCCATGCAGGGG No data
1018996465_1018996470 -10 Left 1018996465 6:168714129-168714151 CCCGTCCAGTCATCTGTGGTCAC No data
Right 1018996470 6:168714142-168714164 CTGTGGTCACGCCCATGCAGGGG No data
1018996461_1018996470 10 Left 1018996461 6:168714109-168714131 CCTCAGAGCCTGGCCAAGTGCCC No data
Right 1018996470 6:168714142-168714164 CTGTGGTCACGCCCATGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1018996470 Original CRISPR CTGTGGTCACGCCCATGCAG GGG Intergenic
No off target data available for this crispr